Incidental Mutation 'RF013:Otop2'
ID 603356
Institutional Source Beutler Lab
Gene Symbol Otop2
Ensembl Gene ENSMUSG00000050201
Gene Name otopetrin 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 115307163-115332303 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 115323666 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 83 (R83L)
Ref Sequence ENSEMBL: ENSMUSP00000062109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055490] [ENSMUST00000103037] [ENSMUST00000106544]
AlphaFold Q80SX5
Predicted Effect probably benign
Transcript: ENSMUST00000055490
AA Change: R83L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000062109
Gene: ENSMUSG00000050201
AA Change: R83L

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 225 1e-18 PFAM
Pfam:Otopetrin 214 451 5.5e-20 PFAM
Pfam:Otopetrin 479 550 8.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103037
SMART Domains Protein: ENSMUSP00000099326
Gene: ENSMUSG00000045288

DomainStartEndE-ValueType
ANK 31 60 1.83e-3 SMART
ANK 64 93 8.07e-5 SMART
ANK 97 126 6.26e-2 SMART
low complexity region 159 190 N/A INTRINSIC
PDB:3PVL|B 295 368 3e-30 PDB
SAM 385 449 1.34e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106544
AA Change: R83L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102154
Gene: ENSMUSG00000050201
AA Change: R83L

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 450 7.9e-54 PFAM
Pfam:Otopetrin 476 550 2e-16 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Otop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Otop2 APN 11 115331909 missense probably damaging 1.00
IGL01832:Otop2 APN 11 115326943 missense probably benign
IGL02114:Otop2 APN 11 115326980 missense possibly damaging 0.64
IGL02432:Otop2 APN 11 115329162 missense probably damaging 0.99
IGL02453:Otop2 APN 11 115324629 nonsense probably null
IGL02986:Otop2 APN 11 115329567 missense probably benign 0.11
IGL03225:Otop2 APN 11 115329807 missense probably damaging 1.00
R0402:Otop2 UTSW 11 115326408 splice site probably benign
R0553:Otop2 UTSW 11 115329462 missense probably damaging 0.98
R1209:Otop2 UTSW 11 115324643 missense possibly damaging 0.70
R1497:Otop2 UTSW 11 115329849 splice site probably null
R1765:Otop2 UTSW 11 115324678 missense probably benign 0.04
R1822:Otop2 UTSW 11 115324628 missense probably benign 0.41
R1926:Otop2 UTSW 11 115326955 missense probably benign 0.00
R2151:Otop2 UTSW 11 115329411 missense possibly damaging 0.90
R2192:Otop2 UTSW 11 115326931 missense possibly damaging 0.63
R2350:Otop2 UTSW 11 115326850 missense probably damaging 0.97
R2352:Otop2 UTSW 11 115329101 missense probably damaging 1.00
R2915:Otop2 UTSW 11 115329146 missense probably benign 0.07
R3614:Otop2 UTSW 11 115329146 missense probably benign 0.07
R4060:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4061:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4062:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4063:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4064:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4184:Otop2 UTSW 11 115329845 missense probably benign 0.05
R4844:Otop2 UTSW 11 115323375 splice site probably null
R5681:Otop2 UTSW 11 115326859 missense probably damaging 1.00
R5713:Otop2 UTSW 11 115329044 missense probably damaging 0.98
R6738:Otop2 UTSW 11 115329492 missense probably damaging 1.00
R6975:Otop2 UTSW 11 115329326 missense possibly damaging 0.93
R8866:Otop2 UTSW 11 115329528 missense probably benign
R9017:Otop2 UTSW 11 115323605 missense probably benign 0.11
R9062:Otop2 UTSW 11 115323639 missense probably benign 0.06
R9205:Otop2 UTSW 11 115329086 missense probably damaging 1.00
R9524:Otop2 UTSW 11 115323677 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCGCAGTGATCCCTTCAAC -3'
(R):5'- AATGAAGCTCCTTCCACCGG -3'

Sequencing Primer
(F):5'- ACCATGTCGGAGGAACTGGTC -3'
(R):5'- GAAGCCCTCCGCCATGTTTG -3'
Posted On 2019-12-04