Incidental Mutation 'RF013:Ercc6l2'
ID 603361
Institutional Source Beutler Lab
Gene Symbol Ercc6l2
Ensembl Gene ENSMUSG00000021470
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms 0610007P08Rik, 1700019D06Rik, 9330134C04Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 63815240-63900302 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63853017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 417 (T417S)
Ref Sequence ENSEMBL: ENSMUSP00000021926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021925] [ENSMUST00000021926] [ENSMUST00000067821] [ENSMUST00000095724] [ENSMUST00000159957]
AlphaFold Q9JIM3
Predicted Effect probably benign
Transcript: ENSMUST00000021925
SMART Domains Protein: ENSMUSP00000021925
Gene: ENSMUSG00000021470

DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 2e-13 BLAST
HELICc 512 589 6.96e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021926
AA Change: T417S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021926
Gene: ENSMUSG00000021470
AA Change: T417S

low complexity region 10 23 N/A INTRINSIC
DEXDc 28 216 1.74e-12 SMART
Blast:DEXDc 265 310 1e-13 BLAST
Blast:DEXDc 317 450 4e-30 BLAST
SCOP:d1hv8a2 388 466 7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067821
AA Change: T532S

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069488
Gene: ENSMUSG00000021470
AA Change: T532S

DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 3e-13 BLAST
HELICc 536 619 3.12e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095724
SMART Domains Protein: ENSMUSP00000093392
Gene: ENSMUSG00000021470

DEXDc 1 183 2.72e-14 SMART
Blast:DEXDc 232 277 3e-13 BLAST
HELICc 388 471 3.12e-23 SMART
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159957
SMART Domains Protein: ENSMUSP00000124912
Gene: ENSMUSG00000021470

Pfam:SNF2_N 101 195 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snf2 family of helicase-like proteins. The encoded protein may play a role in DNA repair and mitochondrial function. Mutations in this gene have been associated with bone marrow failure syndrome 2. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Ercc6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Ercc6l2 APN 13 63858319 missense probably damaging 0.99
IGL00678:Ercc6l2 APN 13 63844613 missense probably damaging 1.00
IGL00765:Ercc6l2 APN 13 63848772 missense possibly damaging 0.95
IGL01062:Ercc6l2 APN 13 63847454 missense probably null 1.00
IGL01655:Ercc6l2 APN 13 63819752 nonsense probably null
IGL02175:Ercc6l2 APN 13 63869190 utr 3 prime probably benign
IGL02201:Ercc6l2 APN 13 63852969 missense probably benign 0.12
IGL02351:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02358:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02622:Ercc6l2 APN 13 63853623 splice site probably null
PIT4812001:Ercc6l2 UTSW 13 63858257 missense possibly damaging 0.58
R0142:Ercc6l2 UTSW 13 63872506 unclassified probably benign
R0648:Ercc6l2 UTSW 13 63844645 missense probably benign 0.04
R1136:Ercc6l2 UTSW 13 63869120 missense possibly damaging 0.75
R1536:Ercc6l2 UTSW 13 63824871 missense possibly damaging 0.81
R1706:Ercc6l2 UTSW 13 63872458 unclassified probably benign
R2108:Ercc6l2 UTSW 13 63871988 unclassified probably benign
R2111:Ercc6l2 UTSW 13 63834749 missense probably damaging 1.00
R2126:Ercc6l2 UTSW 13 63848771 missense probably damaging 1.00
R2154:Ercc6l2 UTSW 13 63866007 missense probably damaging 1.00
R3551:Ercc6l2 UTSW 13 63844595 missense probably damaging 1.00
R3773:Ercc6l2 UTSW 13 63841450 missense probably damaging 1.00
R3923:Ercc6l2 UTSW 13 63870735 unclassified probably benign
R4233:Ercc6l2 UTSW 13 63872168 unclassified probably benign
R4782:Ercc6l2 UTSW 13 63834738 missense probably damaging 1.00
R4928:Ercc6l2 UTSW 13 63894813 utr 3 prime probably benign
R5163:Ercc6l2 UTSW 13 63899031 utr 3 prime probably benign
R5268:Ercc6l2 UTSW 13 63869111 missense possibly damaging 0.92
R5423:Ercc6l2 UTSW 13 63872258 unclassified probably benign
R6128:Ercc6l2 UTSW 13 63853749 missense probably damaging 0.98
R6164:Ercc6l2 UTSW 13 63872344 unclassified probably benign
R7238:Ercc6l2 UTSW 13 63865984 missense probably damaging 0.98
R7295:Ercc6l2 UTSW 13 63819775 missense probably damaging 0.96
R7708:Ercc6l2 UTSW 13 63841514 nonsense probably null
R8085:Ercc6l2 UTSW 13 63844553 missense probably benign 0.00
R8131:Ercc6l2 UTSW 13 63834747 missense probably damaging 1.00
R8259:Ercc6l2 UTSW 13 63872471 missense
R8372:Ercc6l2 UTSW 13 63853749 missense probably damaging 0.98
R8479:Ercc6l2 UTSW 13 63824815 missense possibly damaging 0.95
R9034:Ercc6l2 UTSW 13 63844633 missense probably damaging 0.97
R9065:Ercc6l2 UTSW 13 63820052 missense possibly damaging 0.93
R9557:Ercc6l2 UTSW 13 63842122 missense probably damaging 1.00
R9700:Ercc6l2 UTSW 13 63819711 missense probably benign 0.32
R9763:Ercc6l2 UTSW 13 63834624 missense probably damaging 1.00
Z1088:Ercc6l2 UTSW 13 63853728 missense possibly damaging 0.93
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04