Incidental Mutation 'RF013:Myo10'
ID 603366
Institutional Source Beutler Lab
Gene Symbol Myo10
Ensembl Gene ENSMUSG00000022272
Gene Name myosin X
Synonyms myosin-X, D15Ertd600e
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 25622636-25813759 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25799565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1376 (M1376K)
Ref Sequence ENSEMBL: ENSMUSP00000106087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022882] [ENSMUST00000110457]
AlphaFold F8VQB6
Predicted Effect probably damaging
Transcript: ENSMUST00000022882
AA Change: M630K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022882
Gene: ENSMUSG00000022272
AA Change: M630K

DomainStartEndE-ValueType
IQ 1 17 7.83e1 SMART
IQ 18 40 1.06e0 SMART
IQ 41 63 7.07e-2 SMART
PDB:2LW9|B 136 171 7e-13 PDB
low complexity region 172 186 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
PH 471 570 1.39e-21 SMART
SCOP:d1faoa_ 588 639 3e-6 SMART
PH 651 757 6.76e-11 SMART
MyTH4 805 953 4.12e-37 SMART
B41 954 1216 1.72e-44 SMART
Blast:B41 1218 1303 3e-45 BLAST
low complexity region 1304 1316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110457
AA Change: M1376K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: M1376K

DomainStartEndE-ValueType
MYSc 57 740 N/A SMART
IQ 741 763 1.27e-3 SMART
IQ 764 786 1.06e0 SMART
IQ 787 809 7.07e-2 SMART
Pfam:MYO10_CC 881 932 4.2e-22 PFAM
low complexity region 959 981 N/A INTRINSIC
low complexity region 1090 1102 N/A INTRINSIC
low complexity region 1147 1165 N/A INTRINSIC
PH 1217 1316 1.39e-21 SMART
PH 1397 1503 6.76e-11 SMART
MyTH4 1551 1699 4.12e-37 SMART
B41 1700 1962 1.72e-44 SMART
low complexity region 2050 2062 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Myo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Myo10 APN 15 25,776,466 (GRCm39) missense probably damaging 1.00
IGL01068:Myo10 APN 15 25,739,395 (GRCm39) missense possibly damaging 0.93
IGL01352:Myo10 APN 15 25,701,783 (GRCm39) missense probably damaging 1.00
IGL01388:Myo10 APN 15 25,736,703 (GRCm39) missense possibly damaging 0.55
IGL01460:Myo10 APN 15 25,714,194 (GRCm39) missense probably benign 0.00
IGL01553:Myo10 APN 15 25,776,415 (GRCm39) missense probably damaging 1.00
IGL01732:Myo10 APN 15 25,732,149 (GRCm39) missense probably benign 0.10
IGL01992:Myo10 APN 15 25,799,634 (GRCm39) missense possibly damaging 0.92
IGL02000:Myo10 APN 15 25,808,152 (GRCm39) missense probably damaging 1.00
IGL02045:Myo10 APN 15 25,726,574 (GRCm39) missense probably benign 0.03
IGL02307:Myo10 APN 15 25,776,401 (GRCm39) splice site probably benign
IGL02511:Myo10 APN 15 25,723,975 (GRCm39) missense probably damaging 0.97
IGL03240:Myo10 APN 15 25,701,688 (GRCm39) missense probably damaging 1.00
least UTSW 15 25,726,561 (GRCm39) nonsense probably null
R0037:Myo10 UTSW 15 25,666,618 (GRCm39) intron probably benign
R0153:Myo10 UTSW 15 25,781,324 (GRCm39) missense possibly damaging 0.84
R0282:Myo10 UTSW 15 25,793,253 (GRCm39) missense probably damaging 1.00
R0360:Myo10 UTSW 15 25,804,454 (GRCm39) missense probably damaging 1.00
R0585:Myo10 UTSW 15 25,736,541 (GRCm39) missense probably damaging 1.00
R0617:Myo10 UTSW 15 25,738,091 (GRCm39) missense probably damaging 1.00
R0729:Myo10 UTSW 15 25,722,243 (GRCm39) splice site probably benign
R0771:Myo10 UTSW 15 25,778,264 (GRCm39) missense probably damaging 1.00
R0960:Myo10 UTSW 15 25,801,275 (GRCm39) missense probably damaging 1.00
R1562:Myo10 UTSW 15 25,780,497 (GRCm39) missense possibly damaging 0.81
R1651:Myo10 UTSW 15 25,742,455 (GRCm39) missense probably damaging 1.00
R1789:Myo10 UTSW 15 25,726,611 (GRCm39) critical splice donor site probably null
R1816:Myo10 UTSW 15 25,800,286 (GRCm39) missense probably damaging 1.00
R1835:Myo10 UTSW 15 25,805,673 (GRCm39) missense possibly damaging 0.53
R1908:Myo10 UTSW 15 25,801,308 (GRCm39) missense probably damaging 1.00
R2082:Myo10 UTSW 15 25,786,079 (GRCm39) missense probably damaging 1.00
R2101:Myo10 UTSW 15 25,722,345 (GRCm39) missense probably benign 0.26
R2129:Myo10 UTSW 15 25,781,885 (GRCm39) missense probably benign 0.09
R2141:Myo10 UTSW 15 25,714,194 (GRCm39) missense probably benign
R2142:Myo10 UTSW 15 25,714,194 (GRCm39) missense probably benign
R2920:Myo10 UTSW 15 25,801,226 (GRCm39) missense probably damaging 1.00
R2938:Myo10 UTSW 15 25,795,803 (GRCm39) missense probably damaging 0.99
R3723:Myo10 UTSW 15 25,803,374 (GRCm39) missense probably damaging 1.00
R3852:Myo10 UTSW 15 25,779,712 (GRCm39) missense probably damaging 1.00
R4162:Myo10 UTSW 15 25,726,501 (GRCm39) splice site probably null
R4163:Myo10 UTSW 15 25,726,501 (GRCm39) splice site probably null
R4164:Myo10 UTSW 15 25,726,501 (GRCm39) splice site probably null
R4177:Myo10 UTSW 15 25,734,137 (GRCm39) missense possibly damaging 0.81
R4409:Myo10 UTSW 15 25,807,955 (GRCm39) missense probably damaging 1.00
R4667:Myo10 UTSW 15 25,793,239 (GRCm39) missense possibly damaging 0.91
R4905:Myo10 UTSW 15 25,800,298 (GRCm39) missense probably damaging 0.99
R4933:Myo10 UTSW 15 25,781,204 (GRCm39) missense probably damaging 0.96
R4968:Myo10 UTSW 15 25,808,270 (GRCm39) missense probably damaging 1.00
R5081:Myo10 UTSW 15 25,786,026 (GRCm39) missense probably damaging 1.00
R5123:Myo10 UTSW 15 25,726,569 (GRCm39) missense possibly damaging 0.94
R5310:Myo10 UTSW 15 25,778,164 (GRCm39) splice site probably null
R6073:Myo10 UTSW 15 25,736,728 (GRCm39) missense probably damaging 1.00
R6117:Myo10 UTSW 15 25,805,745 (GRCm39) missense probably benign 0.00
R6185:Myo10 UTSW 15 25,726,596 (GRCm39) missense probably damaging 0.99
R6749:Myo10 UTSW 15 25,714,196 (GRCm39) missense probably damaging 1.00
R6819:Myo10 UTSW 15 25,781,496 (GRCm39) missense possibly damaging 0.80
R6875:Myo10 UTSW 15 25,805,745 (GRCm39) missense probably benign 0.00
R6908:Myo10 UTSW 15 25,804,469 (GRCm39) missense probably damaging 1.00
R6963:Myo10 UTSW 15 25,734,149 (GRCm39) missense probably benign 0.31
R7144:Myo10 UTSW 15 25,724,011 (GRCm39) missense probably damaging 1.00
R7266:Myo10 UTSW 15 25,783,067 (GRCm39) missense probably damaging 1.00
R7380:Myo10 UTSW 15 25,779,706 (GRCm39) missense probably benign 0.01
R7460:Myo10 UTSW 15 25,807,913 (GRCm39) missense probably damaging 1.00
R7614:Myo10 UTSW 15 25,701,709 (GRCm39) missense probably benign 0.00
R7618:Myo10 UTSW 15 25,726,561 (GRCm39) nonsense probably null
R7717:Myo10 UTSW 15 25,732,056 (GRCm39) missense probably benign 0.01
R7811:Myo10 UTSW 15 25,804,610 (GRCm39) missense probably damaging 1.00
R7830:Myo10 UTSW 15 25,738,057 (GRCm39) nonsense probably null
R7862:Myo10 UTSW 15 25,666,522 (GRCm39) missense probably damaging 1.00
R8232:Myo10 UTSW 15 25,804,400 (GRCm39) missense possibly damaging 0.89
R8264:Myo10 UTSW 15 25,800,195 (GRCm39) missense probably damaging 0.99
R8377:Myo10 UTSW 15 25,804,481 (GRCm39) missense possibly damaging 0.94
R8385:Myo10 UTSW 15 25,804,484 (GRCm39) missense probably damaging 1.00
R8426:Myo10 UTSW 15 25,799,576 (GRCm39) missense probably damaging 0.99
R8439:Myo10 UTSW 15 25,725,158 (GRCm39) missense probably benign 0.00
R8696:Myo10 UTSW 15 25,799,572 (GRCm39) missense probably damaging 1.00
R8775:Myo10 UTSW 15 25,800,145 (GRCm39) missense probably damaging 0.97
R8775-TAIL:Myo10 UTSW 15 25,800,145 (GRCm39) missense probably damaging 0.97
R8970:Myo10 UTSW 15 25,803,467 (GRCm39) missense possibly damaging 0.82
R9024:Myo10 UTSW 15 25,793,295 (GRCm39) missense possibly damaging 0.53
R9196:Myo10 UTSW 15 25,805,716 (GRCm39) missense probably damaging 0.96
R9224:Myo10 UTSW 15 25,808,081 (GRCm39) missense probably benign 0.33
R9308:Myo10 UTSW 15 25,781,862 (GRCm39) missense probably damaging 0.99
R9358:Myo10 UTSW 15 25,781,520 (GRCm39) missense possibly damaging 0.69
R9606:Myo10 UTSW 15 25,776,401 (GRCm39) frame shift probably null
R9722:Myo10 UTSW 15 25,801,227 (GRCm39) missense probably damaging 1.00
Z1177:Myo10 UTSW 15 25,799,640 (GRCm39) critical splice donor site probably null
Z1177:Myo10 UTSW 15 25,781,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGCATTCCAGTGTCTCCG -3'
(R):5'- CAAACTCCTCTGTCCAAATAACTTG -3'

Sequencing Primer
(F):5'- ATTCCAGTGTCTCCGGGGAG -3'
(R):5'- CTGAAGGGATGGCTCTCACATACTG -3'
Posted On 2019-12-04