Incidental Mutation 'RF013:Myo10'
ID 603366
Institutional Source Beutler Lab
Gene Symbol Myo10
Ensembl Gene ENSMUSG00000022272
Gene Name myosin X
Synonyms D15Ertd600e, myosin-X
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 25622525-25813673 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25799479 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1376 (M1376K)
Ref Sequence ENSEMBL: ENSMUSP00000106087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022882] [ENSMUST00000110457]
AlphaFold F8VQB6
Predicted Effect probably damaging
Transcript: ENSMUST00000022882
AA Change: M630K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022882
Gene: ENSMUSG00000022272
AA Change: M630K

DomainStartEndE-ValueType
IQ 1 17 7.83e1 SMART
IQ 18 40 1.06e0 SMART
IQ 41 63 7.07e-2 SMART
PDB:2LW9|B 136 171 7e-13 PDB
low complexity region 172 186 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
PH 471 570 1.39e-21 SMART
SCOP:d1faoa_ 588 639 3e-6 SMART
PH 651 757 6.76e-11 SMART
MyTH4 805 953 4.12e-37 SMART
B41 954 1216 1.72e-44 SMART
Blast:B41 1218 1303 3e-45 BLAST
low complexity region 1304 1316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110457
AA Change: M1376K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: M1376K

DomainStartEndE-ValueType
MYSc 57 740 N/A SMART
IQ 741 763 1.27e-3 SMART
IQ 764 786 1.06e0 SMART
IQ 787 809 7.07e-2 SMART
Pfam:MYO10_CC 881 932 4.2e-22 PFAM
low complexity region 959 981 N/A INTRINSIC
low complexity region 1090 1102 N/A INTRINSIC
low complexity region 1147 1165 N/A INTRINSIC
PH 1217 1316 1.39e-21 SMART
PH 1397 1503 6.76e-11 SMART
MyTH4 1551 1699 4.12e-37 SMART
B41 1700 1962 1.72e-44 SMART
low complexity region 2050 2062 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Myo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Myo10 APN 15 25776380 missense probably damaging 1.00
IGL01068:Myo10 APN 15 25739309 missense possibly damaging 0.93
IGL01352:Myo10 APN 15 25701697 missense probably damaging 1.00
IGL01388:Myo10 APN 15 25736617 missense possibly damaging 0.55
IGL01460:Myo10 APN 15 25714108 missense probably benign 0.00
IGL01553:Myo10 APN 15 25776329 missense probably damaging 1.00
IGL01732:Myo10 APN 15 25732063 missense probably benign 0.10
IGL01992:Myo10 APN 15 25799548 missense possibly damaging 0.92
IGL02000:Myo10 APN 15 25808066 missense probably damaging 1.00
IGL02045:Myo10 APN 15 25726488 missense probably benign 0.03
IGL02307:Myo10 APN 15 25776315 splice site probably benign
IGL02511:Myo10 APN 15 25723889 missense probably damaging 0.97
IGL03240:Myo10 APN 15 25701602 missense probably damaging 1.00
least UTSW 15 25726475 nonsense probably null
R0037:Myo10 UTSW 15 25666532 intron probably benign
R0153:Myo10 UTSW 15 25781238 missense possibly damaging 0.84
R0282:Myo10 UTSW 15 25793167 missense probably damaging 1.00
R0360:Myo10 UTSW 15 25804368 missense probably damaging 1.00
R0585:Myo10 UTSW 15 25736455 missense probably damaging 1.00
R0617:Myo10 UTSW 15 25738005 missense probably damaging 1.00
R0729:Myo10 UTSW 15 25722157 splice site probably benign
R0771:Myo10 UTSW 15 25778178 missense probably damaging 1.00
R0960:Myo10 UTSW 15 25801189 missense probably damaging 1.00
R1562:Myo10 UTSW 15 25780411 missense possibly damaging 0.81
R1651:Myo10 UTSW 15 25742369 missense probably damaging 1.00
R1789:Myo10 UTSW 15 25726525 critical splice donor site probably null
R1816:Myo10 UTSW 15 25800200 missense probably damaging 1.00
R1835:Myo10 UTSW 15 25805587 missense possibly damaging 0.53
R1908:Myo10 UTSW 15 25801222 missense probably damaging 1.00
R2082:Myo10 UTSW 15 25785993 missense probably damaging 1.00
R2101:Myo10 UTSW 15 25722259 missense probably benign 0.26
R2129:Myo10 UTSW 15 25781799 missense probably benign 0.09
R2141:Myo10 UTSW 15 25714108 missense probably benign
R2142:Myo10 UTSW 15 25714108 missense probably benign
R2920:Myo10 UTSW 15 25801140 missense probably damaging 1.00
R2938:Myo10 UTSW 15 25795717 missense probably damaging 0.99
R3723:Myo10 UTSW 15 25803288 missense probably damaging 1.00
R3852:Myo10 UTSW 15 25779626 missense probably damaging 1.00
R4162:Myo10 UTSW 15 25726415 splice site probably null
R4163:Myo10 UTSW 15 25726415 splice site probably null
R4164:Myo10 UTSW 15 25726415 splice site probably null
R4177:Myo10 UTSW 15 25734051 missense possibly damaging 0.81
R4409:Myo10 UTSW 15 25807869 missense probably damaging 1.00
R4667:Myo10 UTSW 15 25793153 missense possibly damaging 0.91
R4905:Myo10 UTSW 15 25800212 missense probably damaging 0.99
R4933:Myo10 UTSW 15 25781118 missense probably damaging 0.96
R4968:Myo10 UTSW 15 25808184 missense probably damaging 1.00
R5081:Myo10 UTSW 15 25785940 missense probably damaging 1.00
R5123:Myo10 UTSW 15 25726483 missense possibly damaging 0.94
R5310:Myo10 UTSW 15 25778078 splice site probably null
R6073:Myo10 UTSW 15 25736642 missense probably damaging 1.00
R6117:Myo10 UTSW 15 25805659 missense probably benign 0.00
R6185:Myo10 UTSW 15 25726510 missense probably damaging 0.99
R6749:Myo10 UTSW 15 25714110 missense probably damaging 1.00
R6819:Myo10 UTSW 15 25781410 missense possibly damaging 0.80
R6875:Myo10 UTSW 15 25805659 missense probably benign 0.00
R6908:Myo10 UTSW 15 25804383 missense probably damaging 1.00
R6963:Myo10 UTSW 15 25734063 missense probably benign 0.31
R7144:Myo10 UTSW 15 25723925 missense probably damaging 1.00
R7266:Myo10 UTSW 15 25782981 missense probably damaging 1.00
R7380:Myo10 UTSW 15 25779620 missense probably benign 0.01
R7460:Myo10 UTSW 15 25807827 missense probably damaging 1.00
R7614:Myo10 UTSW 15 25701623 missense probably benign 0.00
R7618:Myo10 UTSW 15 25726475 nonsense probably null
R7717:Myo10 UTSW 15 25731970 missense probably benign 0.01
R7811:Myo10 UTSW 15 25804524 missense probably damaging 1.00
R7830:Myo10 UTSW 15 25737971 nonsense probably null
R7862:Myo10 UTSW 15 25666436 missense probably damaging 1.00
R8232:Myo10 UTSW 15 25804314 missense possibly damaging 0.89
R8264:Myo10 UTSW 15 25800109 missense probably damaging 0.99
R8377:Myo10 UTSW 15 25804395 missense possibly damaging 0.94
R8385:Myo10 UTSW 15 25804398 missense probably damaging 1.00
R8426:Myo10 UTSW 15 25799490 missense probably damaging 0.99
R8439:Myo10 UTSW 15 25725072 missense probably benign 0.00
R8696:Myo10 UTSW 15 25799486 missense probably damaging 1.00
R8775:Myo10 UTSW 15 25800059 missense probably damaging 0.97
R8775-TAIL:Myo10 UTSW 15 25800059 missense probably damaging 0.97
R8970:Myo10 UTSW 15 25803381 missense possibly damaging 0.82
R9024:Myo10 UTSW 15 25793209 missense possibly damaging 0.53
R9196:Myo10 UTSW 15 25805630 missense probably damaging 0.96
R9224:Myo10 UTSW 15 25807995 missense probably benign 0.33
R9308:Myo10 UTSW 15 25781776 missense probably damaging 0.99
R9358:Myo10 UTSW 15 25781434 missense possibly damaging 0.69
R9606:Myo10 UTSW 15 25776315 frame shift probably null
R9722:Myo10 UTSW 15 25801141 missense probably damaging 1.00
Z1177:Myo10 UTSW 15 25781401 missense probably damaging 1.00
Z1177:Myo10 UTSW 15 25799554 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATAGCATTCCAGTGTCTCCG -3'
(R):5'- CAAACTCCTCTGTCCAAATAACTTG -3'

Sequencing Primer
(F):5'- ATTCCAGTGTCTCCGGGGAG -3'
(R):5'- CTGAAGGGATGGCTCTCACATACTG -3'
Posted On 2019-12-04