Incidental Mutation 'RF013:4930435E12Rik'
ID 603369
Institutional Source Beutler Lab
Gene Symbol 4930435E12Rik
Ensembl Gene ENSMUSG00000022798
Gene Name RIKEN cDNA 4930435E12 gene
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 38812206-38828749 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38828001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 249 (T249A)
Ref Sequence ENSEMBL: ENSMUSP00000113120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122078]
AlphaFold A6X8Z9
Predicted Effect probably benign
Transcript: ENSMUST00000122078
AA Change: T249A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113120
Gene: ENSMUSG00000022798
AA Change: T249A

low complexity region 86 97 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
low complexity region 307 317 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in 4930435E12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:4930435E12Rik APN 16 38827893 missense possibly damaging 0.61
IGL01998:4930435E12Rik APN 16 38828224 missense probably benign 0.00
IGL02454:4930435E12Rik APN 16 38827947 missense probably benign 0.02
IGL03216:4930435E12Rik APN 16 38828690 missense possibly damaging 0.59
IGL03325:4930435E12Rik APN 16 38827993 missense probably damaging 1.00
IGL03397:4930435E12Rik APN 16 38828693 missense probably damaging 1.00
R7924_4930435E12Rik_239 UTSW 16 38812464 nonsense probably null
BB001:4930435E12Rik UTSW 16 38812464 nonsense probably null
BB011:4930435E12Rik UTSW 16 38812464 nonsense probably null
R0242:4930435E12Rik UTSW 16 38824567 splice site probably benign
R0446:4930435E12Rik UTSW 16 38828702 missense probably benign 0.01
R0607:4930435E12Rik UTSW 16 38828364 missense probably benign 0.02
R1918:4930435E12Rik UTSW 16 38828088 missense possibly damaging 0.56
R1953:4930435E12Rik UTSW 16 38827913 missense possibly damaging 0.78
R3417:4930435E12Rik UTSW 16 38828740 missense probably benign 0.17
R4601:4930435E12Rik UTSW 16 38828018 missense probably benign 0.14
R4860:4930435E12Rik UTSW 16 38828145 missense probably damaging 0.97
R4860:4930435E12Rik UTSW 16 38828145 missense probably damaging 0.97
R5551:4930435E12Rik UTSW 16 38827974 missense probably benign 0.28
R7568:4930435E12Rik UTSW 16 38828447 missense possibly damaging 0.95
R7623:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7643:4930435E12Rik UTSW 16 38827863 missense probably benign 0.15
R7669:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7670:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7671:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7924:4930435E12Rik UTSW 16 38812464 nonsense probably null
R9385:4930435E12Rik UTSW 16 38828045 missense probably benign 0.11
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04