Incidental Mutation 'RF013:Tubb4a'
ID 603372
Institutional Source Beutler Lab
Gene Symbol Tubb4a
Ensembl Gene ENSMUSG00000062591
Gene Name tubulin, beta 4A class IVA
Synonyms Tubb, Tubb4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 57080066-57087782 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 57087464 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Alanine at position 17 (G17A)
Ref Sequence ENSEMBL: ENSMUSP00000071135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071135] [ENSMUST00000112915]
AlphaFold Q9D6F9
Predicted Effect possibly damaging
Transcript: ENSMUST00000071135
AA Change: G17A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071135
Gene: ENSMUSG00000062591
AA Change: G17A

DomainStartEndE-ValueType
Tubulin 47 244 4.45e-67 SMART
Tubulin_C 246 383 5.5e-49 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112915
SMART Domains Protein: ENSMUSP00000108537
Gene: ENSMUSG00000079414

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. Mutations in this gene cause hypomyelinating leukodystrophy-6 and autosomal dominant torsion dystonia-4. Alternate splicing results in multiple transcript variants encoding different isoforms. A pseudogene of this gene is found on chromosome X. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Tubb4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Tubb4a APN 17 57086072 missense probably benign 0.24
IGL02343:Tubb4a APN 17 57081538 missense probably benign
IGL02562:Tubb4a APN 17 57081163 nonsense probably null
G1citation:Tubb4a UTSW 17 57080904 missense probably damaging 0.99
P0022:Tubb4a UTSW 17 57081538 missense probably benign
R0043:Tubb4a UTSW 17 57081114 missense probably damaging 1.00
R0195:Tubb4a UTSW 17 57081499 missense probably damaging 1.00
R0309:Tubb4a UTSW 17 57081182 nonsense probably null
R0348:Tubb4a UTSW 17 57080770 missense probably damaging 0.98
R2440:Tubb4a UTSW 17 57086285 missense probably damaging 1.00
R2762:Tubb4a UTSW 17 57080974 missense probably benign
R3927:Tubb4a UTSW 17 57080967 missense probably benign 0.00
R6284:Tubb4a UTSW 17 57080833 missense probably damaging 1.00
R6351:Tubb4a UTSW 17 57081016 missense probably damaging 1.00
R6760:Tubb4a UTSW 17 57080796 missense possibly damaging 0.82
R6822:Tubb4a UTSW 17 57080904 missense probably damaging 0.99
R7381:Tubb4a UTSW 17 57080698 missense unknown
R7507:Tubb4a UTSW 17 57081642 missense probably damaging 1.00
R7892:Tubb4a UTSW 17 57080880 nonsense probably null
R8991:Tubb4a UTSW 17 57081169 missense probably benign 0.00
R9108:Tubb4a UTSW 17 57081232 missense probably benign 0.02
R9165:Tubb4a UTSW 17 57080734 missense unknown
R9215:Tubb4a UTSW 17 57080769 missense probably damaging 0.99
R9245:Tubb4a UTSW 17 57080959 missense possibly damaging 0.56
R9251:Tubb4a UTSW 17 57080778 missense possibly damaging 0.56
R9432:Tubb4a UTSW 17 57081034 missense probably benign
R9565:Tubb4a UTSW 17 57081027 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCCAAGAGACATAAGGCC -3'
(R):5'- GGAGATCCCTACTTTTCCGAG -3'

Sequencing Primer
(F):5'- CAAAATTCCTGGGTGAGC -3'
(R):5'- CGTGAGTACTGCTCCGCAAATATAG -3'
Posted On 2019-12-04