Incidental Mutation 'RF013:Alk'
ID 603374
Institutional Source Beutler Lab
Gene Symbol Alk
Ensembl Gene ENSMUSG00000055471
Gene Name anaplastic lymphoma kinase
Synonyms CD246, Tcrz
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 72175967-72911622 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72202931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1135 (Y1135H)
Ref Sequence ENSEMBL: ENSMUSP00000083840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086639]
AlphaFold P97793
Predicted Effect probably damaging
Transcript: ENSMUST00000086639
AA Change: Y1135H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083840
Gene: ENSMUSG00000055471
AA Change: Y1135H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:MAM 270 431 5.6e-10 PFAM
LDLa 441 477 5.59e-3 SMART
Pfam:MAM 484 640 5.6e-22 PFAM
Pfam:Gly_rich 730 996 8.6e-19 PFAM
low complexity region 1037 1057 N/A INTRINSIC
TyrKc 1120 1387 2.76e-140 SMART
low complexity region 1440 1480 N/A INTRINSIC
low complexity region 1551 1570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele show increased ethanol consumption and increased sedation in response to ethanol. Male mice homozygous for a different null allele show delayed puberty, hypogonadotropic hypogonadism, reduced serum testosterone levels, and altered seminiferous tubule morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Alk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Alk APN 17 72,202,743 (GRCm39) missense probably damaging 1.00
IGL00796:Alk APN 17 72,212,137 (GRCm39) missense possibly damaging 0.88
IGL01096:Alk APN 17 72,228,891 (GRCm39) missense possibly damaging 0.87
IGL01367:Alk APN 17 72,207,781 (GRCm39) missense probably damaging 1.00
IGL01402:Alk APN 17 72,181,173 (GRCm39) missense probably damaging 1.00
IGL01652:Alk APN 17 72,910,526 (GRCm39) missense probably damaging 1.00
IGL01717:Alk APN 17 72,910,377 (GRCm39) missense probably benign
IGL02301:Alk APN 17 72,181,171 (GRCm39) missense probably damaging 0.99
IGL02403:Alk APN 17 72,208,388 (GRCm39) missense probably damaging 1.00
IGL02452:Alk APN 17 72,209,620 (GRCm39) nonsense probably null
IGL02724:Alk APN 17 72,292,455 (GRCm39) missense probably benign 0.00
IGL02826:Alk APN 17 72,176,531 (GRCm39) missense probably damaging 1.00
IGL02863:Alk APN 17 72,204,830 (GRCm39) missense probably damaging 1.00
IGL02994:Alk APN 17 72,256,815 (GRCm39) missense probably benign 0.00
IGL03329:Alk APN 17 72,206,159 (GRCm39) splice site probably benign
PIT4382001:Alk UTSW 17 72,256,916 (GRCm39) missense probably benign
R0157:Alk UTSW 17 72,256,840 (GRCm39) missense probably benign 0.00
R0211:Alk UTSW 17 72,910,511 (GRCm39) missense probably damaging 1.00
R0257:Alk UTSW 17 72,910,490 (GRCm39) missense probably damaging 1.00
R0269:Alk UTSW 17 72,910,578 (GRCm39) missense probably damaging 1.00
R0395:Alk UTSW 17 72,910,526 (GRCm39) missense probably damaging 0.99
R0414:Alk UTSW 17 72,206,281 (GRCm39) splice site probably benign
R0466:Alk UTSW 17 72,212,152 (GRCm39) missense possibly damaging 0.51
R0526:Alk UTSW 17 72,176,748 (GRCm39) missense probably damaging 1.00
R0617:Alk UTSW 17 72,910,578 (GRCm39) missense probably damaging 1.00
R0781:Alk UTSW 17 72,291,740 (GRCm39) splice site probably benign
R0830:Alk UTSW 17 72,910,195 (GRCm39) missense probably benign 0.01
R0835:Alk UTSW 17 72,176,837 (GRCm39) missense probably damaging 0.97
R0894:Alk UTSW 17 72,202,930 (GRCm39) missense probably damaging 1.00
R1110:Alk UTSW 17 72,291,740 (GRCm39) splice site probably benign
R1170:Alk UTSW 17 72,207,729 (GRCm39) missense probably damaging 1.00
R1573:Alk UTSW 17 72,910,113 (GRCm39) missense possibly damaging 0.69
R1667:Alk UTSW 17 72,218,562 (GRCm39) missense probably damaging 1.00
R1748:Alk UTSW 17 72,910,416 (GRCm39) missense probably benign 0.19
R1767:Alk UTSW 17 72,207,693 (GRCm39) missense possibly damaging 0.73
R1836:Alk UTSW 17 72,198,032 (GRCm39) missense probably damaging 1.00
R1861:Alk UTSW 17 72,181,933 (GRCm39) splice site probably benign
R2905:Alk UTSW 17 72,292,489 (GRCm39) missense probably benign 0.40
R2925:Alk UTSW 17 72,910,202 (GRCm39) missense probably benign
R3727:Alk UTSW 17 72,208,395 (GRCm39) splice site probably benign
R3747:Alk UTSW 17 72,218,560 (GRCm39) missense probably damaging 0.99
R3790:Alk UTSW 17 72,910,427 (GRCm39) missense possibly damaging 0.95
R3909:Alk UTSW 17 72,204,906 (GRCm39) missense probably benign 0.00
R3934:Alk UTSW 17 72,512,949 (GRCm39) missense probably damaging 1.00
R3936:Alk UTSW 17 72,512,949 (GRCm39) missense probably damaging 1.00
R3972:Alk UTSW 17 72,292,442 (GRCm39) missense probably benign 0.16
R4433:Alk UTSW 17 72,206,236 (GRCm39) nonsense probably null
R4716:Alk UTSW 17 72,512,937 (GRCm39) missense probably damaging 1.00
R4903:Alk UTSW 17 72,176,558 (GRCm39) missense probably damaging 1.00
R4921:Alk UTSW 17 72,211,310 (GRCm39) missense probably benign 0.30
R4954:Alk UTSW 17 72,209,687 (GRCm39) nonsense probably null
R5377:Alk UTSW 17 72,202,734 (GRCm39) missense probably damaging 1.00
R5386:Alk UTSW 17 72,182,007 (GRCm39) missense probably damaging 1.00
R5551:Alk UTSW 17 72,182,028 (GRCm39) missense possibly damaging 0.53
R5704:Alk UTSW 17 72,910,115 (GRCm39) missense probably damaging 1.00
R5877:Alk UTSW 17 72,274,521 (GRCm39) missense probably damaging 1.00
R5888:Alk UTSW 17 72,181,938 (GRCm39) missense probably damaging 1.00
R6013:Alk UTSW 17 72,207,732 (GRCm39) missense probably benign 0.15
R6044:Alk UTSW 17 72,299,095 (GRCm39) missense probably benign 0.00
R6058:Alk UTSW 17 72,176,742 (GRCm39) missense probably benign 0.01
R6126:Alk UTSW 17 72,182,037 (GRCm39) missense possibly damaging 0.82
R6286:Alk UTSW 17 72,187,842 (GRCm39) missense probably damaging 0.98
R6744:Alk UTSW 17 72,910,077 (GRCm39) missense probably benign 0.35
R6989:Alk UTSW 17 72,204,947 (GRCm39) missense probably benign 0.00
R7487:Alk UTSW 17 72,256,893 (GRCm39) missense probably benign
R7573:Alk UTSW 17 72,207,787 (GRCm39) missense probably damaging 1.00
R7838:Alk UTSW 17 72,274,549 (GRCm39) missense possibly damaging 0.53
R8055:Alk UTSW 17 72,206,252 (GRCm39) missense probably benign 0.19
R8211:Alk UTSW 17 72,176,702 (GRCm39) missense probably benign
R8555:Alk UTSW 17 72,228,869 (GRCm39) missense probably damaging 1.00
R8676:Alk UTSW 17 72,204,936 (GRCm39) missense probably damaging 0.98
R8847:Alk UTSW 17 72,256,820 (GRCm39) missense probably benign 0.14
R8885:Alk UTSW 17 72,202,758 (GRCm39) missense probably damaging 1.00
R9177:Alk UTSW 17 72,181,190 (GRCm39) missense probably damaging 1.00
R9239:Alk UTSW 17 72,256,864 (GRCm39) missense probably benign 0.04
R9268:Alk UTSW 17 72,181,190 (GRCm39) missense probably damaging 1.00
R9682:Alk UTSW 17 72,182,058 (GRCm39) missense possibly damaging 0.95
RF018:Alk UTSW 17 72,256,808 (GRCm39) missense probably benign 0.09
Z1088:Alk UTSW 17 72,512,802 (GRCm39) missense probably damaging 0.96
Z1177:Alk UTSW 17 72,910,058 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGTCCAGCTCATCTTGTTCTG -3'
(R):5'- AGGTGTAACTCCTGAGTGGTC -3'

Sequencing Primer
(F):5'- GTTCTGAACACACTTCTGGCAG -3'
(R):5'- GTAACTCCTGAGTGGTCACCCTTC -3'
Posted On 2019-12-04