Incidental Mutation 'RF013:Ankhd1'
ID 603376
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Name ankyrin repeat and KH domain containing 1
Synonyms A530027J04Rik, 9130019P20Rik, 4933432B13Rik, 1110004O12Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 217.468
Status Not validated
Chromosome 18
Chromosomal Location 36693656-36791961 bp(+) (GRCm39)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) CGGCGG to CGGCGGAGGCGG at 36693979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
AlphaFold E9PUR0
Predicted Effect probably benign
Transcript: ENSMUST00000006205
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134146
SMART Domains Protein: ENSMUSP00000122136
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
ANK 140 169 2.11e2 SMART
ANK 173 202 3.31e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142977
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155329
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36,798,512 (GRCm39) unclassified probably benign
IGL00927:Ankhd1 APN 18 36,765,125 (GRCm39) missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36,711,696 (GRCm39) missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36,791,066 (GRCm39) missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36,781,206 (GRCm39) missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36,781,427 (GRCm39) missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36,781,479 (GRCm39) missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36,757,714 (GRCm39) missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36,789,779 (GRCm39) missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36,727,867 (GRCm39) missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36,780,756 (GRCm39) missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36,711,828 (GRCm39) critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36,781,599 (GRCm39) missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36,727,876 (GRCm39) missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36,791,061 (GRCm39) nonsense probably null
IGL03163:Ankhd1 APN 18 36,780,681 (GRCm39) missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36,711,827 (GRCm39) missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36,780,830 (GRCm39) missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36,789,890 (GRCm39) splice site probably benign
FR4304:Ankhd1 UTSW 18 36,693,977 (GRCm39) small insertion probably benign
R0051:Ankhd1 UTSW 18 36,780,241 (GRCm39) unclassified probably benign
R0089:Ankhd1 UTSW 18 36,773,409 (GRCm39) missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36,779,819 (GRCm39) missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36,780,267 (GRCm39) missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36,767,787 (GRCm39) missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36,791,061 (GRCm39) nonsense probably null
R0361:Ankhd1 UTSW 18 36,780,267 (GRCm39) missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36,777,652 (GRCm39) missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36,767,353 (GRCm39) missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36,777,652 (GRCm39) missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36,773,333 (GRCm39) missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36,773,333 (GRCm39) missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36,778,302 (GRCm39) splice site probably benign
R1127:Ankhd1 UTSW 18 36,767,399 (GRCm39) missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36,758,212 (GRCm39) missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36,758,318 (GRCm39) missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36,780,361 (GRCm39) missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36,777,580 (GRCm39) missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36,781,083 (GRCm39) missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36,778,166 (GRCm39) missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36,774,679 (GRCm39) missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36,767,361 (GRCm39) missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36,780,674 (GRCm39) missense probably benign
R2196:Ankhd1 UTSW 18 36,781,432 (GRCm39) missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36,777,386 (GRCm39) missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36,775,979 (GRCm39) missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36,757,818 (GRCm39) missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36,711,596 (GRCm39) splice site probably null
R2958:Ankhd1 UTSW 18 36,767,782 (GRCm39) missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36,780,666 (GRCm39) missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36,780,666 (GRCm39) missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36,722,593 (GRCm39) missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36,794,101 (GRCm39) unclassified probably benign
R4323:Ankhd1 UTSW 18 36,711,686 (GRCm39) missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36,776,096 (GRCm39) nonsense probably null
R4496:Ankhd1 UTSW 18 36,693,839 (GRCm39) missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36,788,560 (GRCm39) splice site probably null
R4590:Ankhd1 UTSW 18 36,716,697 (GRCm39) missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36,781,074 (GRCm39) missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36,711,787 (GRCm39) missense probably null 0.00
R4923:Ankhd1 UTSW 18 36,722,505 (GRCm39) missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36,758,080 (GRCm39) missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36,789,768 (GRCm39) missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36,694,111 (GRCm39) splice site probably null
R5336:Ankhd1 UTSW 18 36,779,769 (GRCm39) missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36,722,461 (GRCm39) missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36,724,548 (GRCm39) missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36,724,548 (GRCm39) missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36,767,697 (GRCm39) missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36,781,538 (GRCm39) missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36,693,860 (GRCm39) missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36,694,103 (GRCm39) missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36,757,955 (GRCm39) missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36,773,322 (GRCm39) missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36,780,577 (GRCm39) missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36,733,887 (GRCm39) missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36,758,179 (GRCm39) missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36,744,862 (GRCm39) missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36,787,199 (GRCm39) missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36,724,509 (GRCm39) missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36,733,836 (GRCm39) splice site probably null
R6653:Ankhd1 UTSW 18 36,733,836 (GRCm39) splice site probably null
R6763:Ankhd1 UTSW 18 36,776,022 (GRCm39) missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36,781,307 (GRCm39) missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36,693,042 (GRCm39) missense
R7208:Ankhd1 UTSW 18 36,758,081 (GRCm39) missense probably benign
R7305:Ankhd1 UTSW 18 36,765,258 (GRCm39) missense
R7615:Ankhd1 UTSW 18 36,789,826 (GRCm39) missense
R7654:Ankhd1 UTSW 18 36,727,154 (GRCm39) missense probably damaging 1.00
R7781:Ankhd1 UTSW 18 36,758,258 (GRCm39) missense probably damaging 1.00
R7842:Ankhd1 UTSW 18 36,780,881 (GRCm39) missense probably benign 0.00
R7965:Ankhd1 UTSW 18 36,791,465 (GRCm39) missense
R8006:Ankhd1 UTSW 18 36,781,772 (GRCm39) missense
R8037:Ankhd1 UTSW 18 36,771,676 (GRCm39) missense probably damaging 0.98
R8123:Ankhd1 UTSW 18 36,708,136 (GRCm39) missense
R8195:Ankhd1 UTSW 18 36,787,230 (GRCm39) missense
R8305:Ankhd1 UTSW 18 36,780,219 (GRCm39) missense possibly damaging 0.79
R8708:Ankhd1 UTSW 18 36,727,344 (GRCm39) missense probably damaging 1.00
R8827:Ankhd1 UTSW 18 36,757,633 (GRCm39) nonsense probably null
R9138:Ankhd1 UTSW 18 36,693,961 (GRCm39) small deletion probably benign
R9139:Ankhd1 UTSW 18 36,711,810 (GRCm39) missense
R9186:Ankhd1 UTSW 18 36,767,383 (GRCm39) missense possibly damaging 0.95
R9245:Ankhd1 UTSW 18 36,788,653 (GRCm39) missense
R9254:Ankhd1 UTSW 18 36,777,680 (GRCm39) missense probably benign 0.03
R9262:Ankhd1 UTSW 18 36,765,799 (GRCm39) missense
R9379:Ankhd1 UTSW 18 36,777,680 (GRCm39) missense probably benign 0.03
R9436:Ankhd1 UTSW 18 36,774,654 (GRCm39) missense probably benign 0.04
R9436:Ankhd1 UTSW 18 36,694,041 (GRCm39) missense probably benign 0.39
R9541:Ankhd1 UTSW 18 36,757,697 (GRCm39) missense
R9584:Ankhd1 UTSW 18 36,798,504 (GRCm39) missense probably benign 0.06
R9664:Ankhd1 UTSW 18 36,780,878 (GRCm39) missense probably benign 0.03
RF001:Ankhd1 UTSW 18 36,693,974 (GRCm39) small insertion probably benign
RF004:Ankhd1 UTSW 18 36,693,963 (GRCm39) small insertion probably benign
RF007:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF008:Ankhd1 UTSW 18 36,693,977 (GRCm39) small insertion probably benign
RF009:Ankhd1 UTSW 18 36,693,975 (GRCm39) small insertion probably benign
RF016:Ankhd1 UTSW 18 36,693,963 (GRCm39) small insertion probably benign
RF016:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF017:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF018:Ankhd1 UTSW 18 36,693,965 (GRCm39) small insertion probably benign
RF026:Ankhd1 UTSW 18 36,693,965 (GRCm39) small insertion probably benign
RF030:Ankhd1 UTSW 18 36,693,980 (GRCm39) small insertion probably benign
RF030:Ankhd1 UTSW 18 36,693,966 (GRCm39) small insertion probably benign
RF039:Ankhd1 UTSW 18 36,693,971 (GRCm39) small insertion probably benign
RF043:Ankhd1 UTSW 18 36,693,970 (GRCm39) small insertion probably benign
RF046:Ankhd1 UTSW 18 36,693,979 (GRCm39) small insertion probably benign
RF047:Ankhd1 UTSW 18 36,693,976 (GRCm39) small insertion probably benign
RF047:Ankhd1 UTSW 18 36,693,970 (GRCm39) small insertion probably benign
RF049:Ankhd1 UTSW 18 36,693,976 (GRCm39) small insertion probably benign
RF050:Ankhd1 UTSW 18 36,693,980 (GRCm39) small insertion probably benign
RF054:Ankhd1 UTSW 18 36,693,982 (GRCm39) small insertion probably benign
RF057:Ankhd1 UTSW 18 36,693,982 (GRCm39) small insertion probably benign
RF060:Ankhd1 UTSW 18 36,693,975 (GRCm39) small insertion probably benign
RF061:Ankhd1 UTSW 18 36,693,974 (GRCm39) small insertion probably benign
RF062:Ankhd1 UTSW 18 36,693,971 (GRCm39) small insertion probably benign
X0027:Ankhd1 UTSW 18 36,757,885 (GRCm39) missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36,711,817 (GRCm39) nonsense probably null
X0066:Ankhd1 UTSW 18 36,779,757 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAACCATGCTGACGGAC -3'
(R):5'- GCTGTCAGAGAACACTGCAC -3'

Sequencing Primer
(F):5'- CTGACGGACAGCGGGGG -3'
(R):5'- TGCGGGTCCAAAGAATTCC -3'
Posted On 2019-12-04