Incidental Mutation 'RF013:Tcof1'
ID 603377
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Name treacle ribosome biogenesis factor 1
Synonyms treacle
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF013 (G1)
Quality Score 138.679
Status Not validated
Chromosome 18
Chromosomal Location 60946827-60982043 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GCA to GCACCA at 60968815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172] [ENSMUST00000177343]
AlphaFold O08784
Predicted Effect probably benign
Transcript: ENSMUST00000163446
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175934
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176630
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177172
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177343
SMART Domains Protein: ENSMUSP00000135295
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
low complexity region 59 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adamts9 A G 6: 92,920,126 (GRCm39) V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,475,260 (GRCm39) probably benign Het
Alk A G 17: 72,202,931 (GRCm39) Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,693,979 (GRCm39) probably benign Het
Ano3 A C 2: 110,527,381 (GRCm39) L609R probably benign Het
Bicc1 A G 10: 70,771,660 (GRCm39) probably null Het
Bltp1 TTAT TTATTATTATTATTAGTAT 3: 37,104,906 (GRCm39) probably benign Het
Card6 T C 15: 5,129,624 (GRCm39) I591V probably benign Het
Ccdc121rt2 T A 5: 112,597,937 (GRCm39) N161K probably benign Het
Ccdc18 A G 5: 108,368,582 (GRCm39) N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,619,813 (GRCm39) probably benign Het
Cnpy3 CCT CCTGCT 17: 47,047,670 (GRCm39) probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,755,796 (GRCm39) probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 86,922,485 (GRCm39) probably benign Het
Cyp8b1 A T 9: 121,744,561 (GRCm39) M257K possibly damaging Het
Dbf4 A T 5: 8,447,985 (GRCm39) H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,327,751 (GRCm39) probably benign Het
Ercc6l2 A T 13: 64,000,831 (GRCm39) T417S probably benign Het
Exd2 AGCCACAG A 12: 80,522,706 (GRCm39) probably null Het
Fam171b GC GCAGCATC 2: 83,643,239 (GRCm39) probably benign Het
Flvcr2 T A 12: 85,793,960 (GRCm39) L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,981,149 (GRCm39) probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm4884 C A 7: 40,690,233 (GRCm39) P43Q probably damaging Het
Grm8 A G 6: 27,363,779 (GRCm39) W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 (GRCm39) probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,479,650 (GRCm39) probably benign Het
Kif18b T C 11: 102,803,192 (GRCm39) D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,019,995 (GRCm39) probably benign Het
Lama1 C A 17: 68,088,057 (GRCm39) S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 122,969,059 (GRCm39) probably null Het
Lmna A G 3: 88,391,361 (GRCm39) V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,295,542 (GRCm39) probably null Het
Mboat7 T A 7: 3,694,856 (GRCm39) H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,183,387 (GRCm39) probably benign Het
Morc2a T A 11: 3,626,191 (GRCm39) M225K probably benign Het
Mpdz G A 4: 81,211,829 (GRCm39) A1566V possibly damaging Het
Mpi T C 9: 57,455,924 (GRCm39) D186G probably benign Het
Mtmr12 C A 15: 12,261,984 (GRCm39) N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo10 T A 15: 25,799,565 (GRCm39) M1376K probably damaging Het
Nbas C T 12: 13,329,409 (GRCm39) T118I possibly damaging Het
Nedd4l C T 18: 65,342,751 (GRCm39) R755C probably damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,891,032 (GRCm39) probably benign Het
Numa1 T C 7: 101,648,987 (GRCm39) L906P probably damaging Het
Or6s1 G A 14: 51,308,469 (GRCm39) A127V probably damaging Het
Or7h8 T C 9: 20,124,190 (GRCm39) S182P probably benign Het
Otop2 G T 11: 115,214,492 (GRCm39) R83L probably benign Het
Pmm1 T A 15: 81,842,014 (GRCm39) Q62L probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Ptprj A T 2: 90,301,514 (GRCm39) L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,756,800 (GRCm39) probably benign Het
Rps19 A AGAAAAT 7: 24,588,605 (GRCm39) probably benign Het
Rsrp1 T A 4: 134,651,266 (GRCm39) V10E unknown Het
Sh2d6 C T 6: 72,493,371 (GRCm39) probably null Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Slc6a15 T A 10: 103,236,077 (GRCm39) V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,089,493 (GRCm39) probably benign Het
Sost A T 11: 101,854,958 (GRCm39) I117N probably damaging Het
Spmip5 A G 19: 58,777,726 (GRCm39) F28S probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,183,975 (GRCm39) probably null Het
Tcaf1 C T 6: 42,656,107 (GRCm39) V290I probably benign Het
Tex55 T C 16: 38,648,363 (GRCm39) T249A probably benign Het
Tgfbr1 A G 4: 47,353,354 (GRCm39) I15V unknown Het
Tmem241 A T 18: 12,116,618 (GRCm39) L288Q probably damaging Het
Tnfrsf13b T G 11: 61,032,270 (GRCm39) V100G probably benign Het
Trim66 A G 7: 109,059,960 (GRCm39) S809P probably damaging Het
Tubb4a C G 17: 57,394,464 (GRCm39) G17A possibly damaging Het
Txndc16 A G 14: 45,406,795 (GRCm39) V220A probably benign Het
Zan T A 5: 137,389,982 (GRCm39) Q4830L unknown Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60,947,640 (GRCm39) unclassified probably benign
IGL01339:Tcof1 APN 18 60,951,167 (GRCm39) utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60,964,637 (GRCm39) missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60,981,815 (GRCm39) unclassified probably benign
IGL02513:Tcof1 APN 18 60,964,850 (GRCm39) missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60,949,120 (GRCm39) missense probably benign 0.00
IGL03161:Tcof1 APN 18 60,966,560 (GRCm39) missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60,962,133 (GRCm39) missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60,968,814 (GRCm39) unclassified probably benign
FR4589:Tcof1 UTSW 18 60,961,722 (GRCm39) critical splice donor site probably benign
FR4737:Tcof1 UTSW 18 60,961,722 (GRCm39) critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60,965,010 (GRCm39) missense unknown
R0569:Tcof1 UTSW 18 60,962,107 (GRCm39) missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60,966,605 (GRCm39) missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60,978,904 (GRCm39) missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60,949,352 (GRCm39) missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60,978,904 (GRCm39) missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60,978,904 (GRCm39) missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60,968,922 (GRCm39) missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60,952,026 (GRCm39) splice site probably benign
R1528:Tcof1 UTSW 18 60,948,071 (GRCm39) nonsense probably null
R1643:Tcof1 UTSW 18 60,949,300 (GRCm39) missense possibly damaging 0.72
R1919:Tcof1 UTSW 18 60,949,156 (GRCm39) missense possibly damaging 0.85
R1920:Tcof1 UTSW 18 60,971,927 (GRCm39) missense possibly damaging 0.87
R1921:Tcof1 UTSW 18 60,971,927 (GRCm39) missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60,966,605 (GRCm39) missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60,968,845 (GRCm39) missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60,965,857 (GRCm39) missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60,965,857 (GRCm39) missense possibly damaging 0.85
R2116:Tcof1 UTSW 18 60,965,857 (GRCm39) missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60,965,857 (GRCm39) missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60,964,901 (GRCm39) missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60,970,973 (GRCm39) missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60,965,249 (GRCm39) intron probably benign
R2913:Tcof1 UTSW 18 60,949,156 (GRCm39) missense possibly damaging 0.85
R2914:Tcof1 UTSW 18 60,949,156 (GRCm39) missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60,955,909 (GRCm39) missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60,964,605 (GRCm39) missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60,965,975 (GRCm39) missense possibly damaging 0.84
R4125:Tcof1 UTSW 18 60,952,673 (GRCm39) missense unknown
R5047:Tcof1 UTSW 18 60,964,986 (GRCm39) missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60,951,105 (GRCm39) utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60,964,628 (GRCm39) missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60,952,611 (GRCm39) missense unknown
R5965:Tcof1 UTSW 18 60,966,490 (GRCm39) critical splice donor site probably null
R6301:Tcof1 UTSW 18 60,961,897 (GRCm39) missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60,947,852 (GRCm39) splice site probably null
R6910:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60,976,368 (GRCm39) missense probably damaging 1.00
R7225:Tcof1 UTSW 18 60,961,520 (GRCm39) missense unknown
R7356:Tcof1 UTSW 18 60,951,166 (GRCm39) missense unknown
R7467:Tcof1 UTSW 18 60,964,977 (GRCm39) missense unknown
R7536:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R7804:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R7818:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R7863:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8006:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8007:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8008:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8063:Tcof1 UTSW 18 60,971,834 (GRCm39) missense probably damaging 1.00
R8192:Tcof1 UTSW 18 60,976,375 (GRCm39) missense probably damaging 1.00
R8200:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8203:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8204:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8207:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8217:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8300:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8517:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8518:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8553:Tcof1 UTSW 18 60,964,643 (GRCm39) missense possibly damaging 0.92
R8729:Tcof1 UTSW 18 60,962,145 (GRCm39) missense unknown
R8732:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R8749:Tcof1 UTSW 18 60,962,123 (GRCm39) missense possibly damaging 0.84
R9800:Tcof1 UTSW 18 60,949,558 (GRCm39) missense unknown
RF001:Tcof1 UTSW 18 60,968,811 (GRCm39) unclassified probably benign
RF007:Tcof1 UTSW 18 60,966,640 (GRCm39) small insertion probably benign
RF009:Tcof1 UTSW 18 60,968,815 (GRCm39) unclassified probably benign
RF010:Tcof1 UTSW 18 60,968,816 (GRCm39) unclassified probably benign
RF011:Tcof1 UTSW 18 60,968,811 (GRCm39) unclassified probably benign
RF015:Tcof1 UTSW 18 60,966,656 (GRCm39) small insertion probably benign
RF016:Tcof1 UTSW 18 60,966,647 (GRCm39) small insertion probably benign
RF022:Tcof1 UTSW 18 60,968,807 (GRCm39) unclassified probably benign
RF024:Tcof1 UTSW 18 60,968,810 (GRCm39) unclassified probably benign
RF027:Tcof1 UTSW 18 60,968,808 (GRCm39) unclassified probably benign
RF029:Tcof1 UTSW 18 60,968,807 (GRCm39) unclassified probably benign
RF029:Tcof1 UTSW 18 60,968,817 (GRCm39) unclassified probably benign
RF030:Tcof1 UTSW 18 60,968,795 (GRCm39) unclassified probably benign
RF030:Tcof1 UTSW 18 60,966,646 (GRCm39) small insertion probably benign
RF030:Tcof1 UTSW 18 60,966,640 (GRCm39) small insertion probably benign
RF031:Tcof1 UTSW 18 60,968,817 (GRCm39) unclassified probably benign
RF031:Tcof1 UTSW 18 60,966,637 (GRCm39) small insertion probably benign
RF035:Tcof1 UTSW 18 60,966,625 (GRCm39) small insertion probably benign
RF036:Tcof1 UTSW 18 60,968,808 (GRCm39) unclassified probably benign
RF036:Tcof1 UTSW 18 60,961,480 (GRCm39) small insertion probably benign
RF038:Tcof1 UTSW 18 60,966,638 (GRCm39) small insertion probably benign
RF040:Tcof1 UTSW 18 60,966,655 (GRCm39) small insertion probably benign
RF040:Tcof1 UTSW 18 60,961,480 (GRCm39) small insertion probably benign
RF041:Tcof1 UTSW 18 60,966,648 (GRCm39) small insertion probably benign
RF041:Tcof1 UTSW 18 60,966,644 (GRCm39) small insertion probably benign
RF043:Tcof1 UTSW 18 60,966,644 (GRCm39) small insertion probably benign
RF050:Tcof1 UTSW 18 60,966,651 (GRCm39) small insertion probably benign
RF051:Tcof1 UTSW 18 60,966,651 (GRCm39) small insertion probably benign
RF053:Tcof1 UTSW 18 60,968,819 (GRCm39) unclassified probably benign
RF056:Tcof1 UTSW 18 60,966,647 (GRCm39) small insertion probably benign
RF057:Tcof1 UTSW 18 60,966,638 (GRCm39) small insertion probably benign
RF057:Tcof1 UTSW 18 60,966,637 (GRCm39) small insertion probably benign
RF057:Tcof1 UTSW 18 60,966,636 (GRCm39) small insertion probably benign
RF057:Tcof1 UTSW 18 60,966,643 (GRCm39) small insertion probably benign
RF060:Tcof1 UTSW 18 60,968,816 (GRCm39) unclassified probably benign
RF060:Tcof1 UTSW 18 60,968,819 (GRCm39) unclassified probably benign
RF063:Tcof1 UTSW 18 60,966,645 (GRCm39) small insertion probably benign
RF064:Tcof1 UTSW 18 60,966,646 (GRCm39) small insertion probably benign
RF064:Tcof1 UTSW 18 60,966,643 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCCATCACACAGTGGCTTTG -3'
(R):5'- CCATTCAGATTGGCAGAGAGC -3'

Sequencing Primer
(F):5'- CTTTGCCAGCATGGGGG -3'
(R):5'- GAAGGCTCTTCATGTGCTGCATC -3'
Posted On 2019-12-04