Incidental Mutation 'RF013:Nedd4l'
ID 603378
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # RF013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 64887705-65217831 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65209680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 755 (R755C)
Ref Sequence ENSEMBL: ENSMUSP00000153052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080418
AA Change: R775C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: R775C

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: R896C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: R896C

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224347
AA Change: R755C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably damaging
Transcript: ENSMUST00000226058
AA Change: R775C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
AI837181 GGC GGCTGC 19: 5,425,232 probably benign Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyb5r4 GACACACTGCCCAGGGA GACACACTGCCCAGGGATGTGACACACACACTGCCCAGGGA 9: 87,040,432 probably benign Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGACGGCTGGATCCTGGATCACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 GCCACAGCCACCACA GCCACAGCCACCACATCCACAGCCACCACA 1: 83,042,274 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nefh GACTTGGCCTCACCTGGG GACTTGGCCTCACCTGGGTACTTGGCCTCACCTGGG 11: 4,941,032 probably benign Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rassf6 TC TCTGCCTCACTCATGGTCCTGTAGAGCATTGGGGATCC 5: 90,608,941 probably benign Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65186367 missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8440:Nedd4l UTSW 18 64889055 splice site probably null
R8499:Nedd4l UTSW 18 65209657 missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65165617 missense probably benign
R9025:Nedd4l UTSW 18 65178924 missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65209663 missense probably damaging 0.99
R9482:Nedd4l UTSW 18 64887960 unclassified probably benign
R9498:Nedd4l UTSW 18 65161652 critical splice donor site probably null
R9599:Nedd4l UTSW 18 65210329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCGACTGTTATAAAGGGTGAGAC -3'
(R):5'- AGTTCCTGTGGGTTGAAGCC -3'

Sequencing Primer
(F):5'- AGACAATGCCGGTCTTGG -3'
(R):5'- CCGTGGGTCTCTGTGGAACTAATAC -3'
Posted On 2019-12-04