Incidental Mutation 'RF013:AI837181'
ID 603379
Institutional Source Beutler Lab
Gene Symbol AI837181
Ensembl Gene ENSMUSG00000047423
Gene Name expressed sequence AI837181
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF013 (G1)
Quality Score 122.467
Status Not validated
Chromosome 19
Chromosomal Location 5425157-5427313 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) GGC to GGCTGC at 5425232 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025853] [ENSMUST00000113673] [ENSMUST00000113674] [ENSMUST00000136579] [ENSMUST00000148219] [ENSMUST00000159759]
AlphaFold Q8VD62
Predicted Effect probably benign
Transcript: ENSMUST00000025853
SMART Domains Protein: ENSMUSP00000025853
Gene: ENSMUSG00000024914

Pfam:Histone 4 76 2.1e-8 PFAM
Pfam:CBFD_NFYB_HMF 10 74 1e-20 PFAM
low complexity region 103 123 N/A INTRINSIC
low complexity region 134 155 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113673
SMART Domains Protein: ENSMUSP00000109303
Gene: ENSMUSG00000024914

Pfam:CBFD_NFYB_HMF 1 54 6.7e-14 PFAM
Pfam:Histone 1 56 1.8e-6 PFAM
low complexity region 83 103 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113674
SMART Domains Protein: ENSMUSP00000109304
Gene: ENSMUSG00000024914

Pfam:CBFD_NFYB_HMF 10 74 5e-22 PFAM
low complexity region 114 130 N/A INTRINSIC
low complexity region 141 162 N/A INTRINSIC
low complexity region 179 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136579
SMART Domains Protein: ENSMUSP00000133692
Gene: ENSMUSG00000024914

Pfam:CBFD_NFYB_HMF 1 54 8.7e-14 PFAM
Pfam:Histone 1 56 2.3e-6 PFAM
low complexity region 83 103 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
low complexity region 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148219
SMART Domains Protein: ENSMUSP00000121162
Gene: ENSMUSG00000024914

Pfam:Histone 4 76 9.4e-10 PFAM
Pfam:CBFD_NFYB_HMF 10 74 4.5e-22 PFAM
low complexity region 103 123 N/A INTRINSIC
low complexity region 134 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159759
SMART Domains Protein: ENSMUSP00000125651
Gene: ENSMUSG00000047423

low complexity region 2 25 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
low complexity region 69 82 N/A INTRINSIC
Pfam:DUF1917 139 259 6.1e-19 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,294 F28S probably damaging Het
4930435E12Rik T C 16: 38,828,001 T249A probably benign Het
4932438A13Rik TTAT TTATTATTATTATTAGTAT 3: 37,050,757 probably benign Het
Adamts9 A G 6: 92,943,145 V4A possibly damaging Het
Alk A G 17: 71,895,936 Y1135H probably damaging Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,926 probably benign Het
Ano3 A C 2: 110,697,036 L609R probably benign Het
Bicc1 A G 10: 70,935,830 probably null Het
Card6 T C 15: 5,100,142 I591V probably benign Het
Ccdc18 A G 5: 108,220,716 N1235D probably benign Het
Cd109 TTAT TTATTTATTTATCTAT 9: 78,712,531 probably benign Het
Cnpy3 CCT CCTGCT 17: 46,736,744 probably benign Het
Col6a5 GCAGTC GCAGTCTCCAGTC 9: 105,878,597 probably null Het
Cyp8b1 A T 9: 121,915,495 M257K possibly damaging Het
Dbf4 A T 5: 8,397,985 H408Q possibly damaging Het
Defb22 TTGCGGCA TTGCGGCAGAGCTGGCCTGTGCGGCA 2: 152,485,831 probably benign Het
Ercc6l2 A T 13: 63,853,017 T417S probably benign Het
Exd2 AGCCACAG A 12: 80,475,932 probably null Het
Fam171b GC GCAGCATC 2: 83,812,895 probably benign Het
Flvcr2 T A 12: 85,747,186 L112Q probably damaging Het
Flywch1 GTG GTGGGGGGAGGCTACGTACTCACCCACTCCTTTTG 17: 23,762,175 probably null Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm4884 C A 7: 41,040,809 P43Q probably damaging Het
Gm6588 T A 5: 112,450,071 N161K probably benign Het
Grm8 A G 6: 27,363,780 W579R probably damaging Het
Hsdl2 AG AGCAGCAGCCACAGCTGCCG 4: 59,610,657 probably benign Het
Ivl CTGCTGCTGCTGCTGT C 3: 92,572,343 probably benign Het
Kif18b T C 11: 102,912,366 D506G probably benign Het
Krtap28-10 AGCCAC AGCCACGGCCAC 1: 83,042,135 probably benign Het
Lama1 C A 17: 67,781,062 S1558R Het
Lcmt1 C CCGCGGGGCTT 7: 123,369,836 probably null Het
Lmna A G 3: 88,484,054 V494A probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Mboat7 T A 7: 3,691,857 H52L probably damaging Het
Med12l CAG CAGAAG 3: 59,275,966 probably benign Het
Morc2a T A 11: 3,676,191 M225K probably benign Het
Mpdz G A 4: 81,293,592 A1566V possibly damaging Het
Mpi T C 9: 57,548,641 D186G probably benign Het
Mtmr12 C A 15: 12,261,898 N386K probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myo10 T A 15: 25,799,479 M1376K probably damaging Het
Nbas C T 12: 13,279,408 T118I possibly damaging Het
Nedd4l C T 18: 65,209,680 R755C probably damaging Het
Numa1 T C 7: 101,999,780 L906P probably damaging Het
Olfr750 G A 14: 51,071,012 A127V probably damaging Het
Olfr871 T C 9: 20,212,894 S182P probably benign Het
Otop2 G T 11: 115,323,666 R83L probably benign Het
Pmm1 T A 15: 81,957,813 Q62L probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Ptprj A T 2: 90,471,170 L206* probably null Het
Rps19 A AGAAAAT 7: 24,889,180 probably benign Het
Rsrp1 T A 4: 134,923,955 V10E unknown Het
Sh2d6 C T 6: 72,516,388 probably null Het
Six4 TG T 12: 73,103,582 probably null Het
Slc6a15 T A 10: 103,400,216 V264D probably damaging Het
Snapc5 ATGGAAGAAGAGG A 9: 64,182,211 probably benign Het
Sost A T 11: 101,964,132 I117N probably damaging Het
Tbc1d22a AGGTGTGTG A 15: 86,299,774 probably null Het
Tcaf1 C T 6: 42,679,173 V290I probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tgfbr1 A G 4: 47,353,354 I15V unknown Het
Tmem241 A T 18: 11,983,561 L288Q probably damaging Het
Tnfrsf13b T G 11: 61,141,444 V100G probably benign Het
Trim66 A G 7: 109,460,753 S809P probably damaging Het
Tubb4a C G 17: 57,087,464 G17A possibly damaging Het
Txndc16 A G 14: 45,169,338 V220A probably benign Het
Zan T A 5: 137,391,720 Q4830L unknown Het
Other mutations in AI837181
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:AI837181 UTSW 19 5425231 small insertion probably benign
FR4548:AI837181 UTSW 19 5425237 small insertion probably benign
FR4976:AI837181 UTSW 19 5425229 small insertion probably benign
R0357:AI837181 UTSW 19 5426703 missense possibly damaging 0.49
R1944:AI837181 UTSW 19 5426229 missense probably damaging 0.96
R4846:AI837181 UTSW 19 5426301 missense probably benign 0.23
R7269:AI837181 UTSW 19 5426434 missense probably damaging 1.00
R7561:AI837181 UTSW 19 5426463 missense probably damaging 1.00
R7761:AI837181 UTSW 19 5426291 missense probably benign 0.03
R9057:AI837181 UTSW 19 5426702 missense probably damaging 0.98
RF002:AI837181 UTSW 19 5425234 small insertion probably benign
RF002:AI837181 UTSW 19 5425235 small insertion probably benign
RF008:AI837181 UTSW 19 5425238 small insertion probably benign
RF009:AI837181 UTSW 19 5425234 small insertion probably benign
RF011:AI837181 UTSW 19 5425236 small insertion probably benign
RF012:AI837181 UTSW 19 5425227 small insertion probably benign
RF021:AI837181 UTSW 19 5425234 small insertion probably benign
RF025:AI837181 UTSW 19 5425226 small insertion probably benign
RF026:AI837181 UTSW 19 5425224 small insertion probably benign
RF030:AI837181 UTSW 19 5425226 small insertion probably benign
RF030:AI837181 UTSW 19 5425235 small insertion probably benign
RF031:AI837181 UTSW 19 5425218 small insertion probably benign
RF033:AI837181 UTSW 19 5425224 small insertion probably benign
RF033:AI837181 UTSW 19 5425237 small insertion probably benign
RF035:AI837181 UTSW 19 5425238 small insertion probably benign
RF038:AI837181 UTSW 19 5425226 small insertion probably benign
RF038:AI837181 UTSW 19 5425236 small insertion probably benign
RF041:AI837181 UTSW 19 5425229 small insertion probably benign
RF042:AI837181 UTSW 19 5425217 small insertion probably benign
RF042:AI837181 UTSW 19 5425237 small insertion probably benign
RF045:AI837181 UTSW 19 5425218 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04