Incidental Mutation 'RF014:Olfr432'
ID603385
Institutional Source Beutler Lab
Gene Symbol Olfr432
Ensembl Gene ENSMUSG00000047048
Gene Nameolfactory receptor 432
SynonymsMOR123-2, GA_x6K02T2P20D-21124681-21123743
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #RF014 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174049205-174054752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 174050987 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 205 (I205F)
Ref Sequence ENSEMBL: ENSMUSP00000150301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062665] [ENSMUST00000213211] [ENSMUST00000213381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062665
AA Change: I205F

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000060341
Gene: ENSMUSG00000047048
AA Change: I205F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.7e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 307 1.2e-7 PFAM
Pfam:7tm_1 41 289 6.5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213211
AA Change: I205F

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213381
AA Change: I205F

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,857 probably benign Het
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACCGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Krtap28-10 CCACCACAGCCACAGCCACCACAGCCACAG CCACCACAGCCACAGACACCACAGCCACAGCCACCACAGCCACAG 1: 83,042,251 probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Map1a GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,295 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Thegl CAGCGATCCTCCCCAGTCCCGCA CAGCGATCCTCCCCAGTCCCGCAGGGCGAGCGATCCTCCCCAGTCCCGCA 5: 77,016,400 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Znrd1as CACCACCACCAC CACCACCACCACCACCACCACGACCACCACCAC 17: 36,965,060 probably benign Het
Other mutations in Olfr432
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Olfr432 APN 1 174050685 missense probably damaging 1.00
IGL03002:Olfr432 APN 1 174050625 missense probably benign 0.03
R0020:Olfr432 UTSW 1 174050847 missense probably damaging 0.99
R0386:Olfr432 UTSW 1 174050399 missense probably benign 0.00
R1735:Olfr432 UTSW 1 174050799 missense probably benign
R1932:Olfr432 UTSW 1 174050678 missense probably damaging 1.00
R2363:Olfr432 UTSW 1 174051248 missense probably damaging 1.00
R3930:Olfr432 UTSW 1 174050510 missense probably damaging 1.00
R4024:Olfr432 UTSW 1 174051117 missense probably benign 0.00
R4777:Olfr432 UTSW 1 174050678 missense probably damaging 1.00
R4946:Olfr432 UTSW 1 174050834 missense possibly damaging 0.95
R5250:Olfr432 UTSW 1 174051272 missense probably benign
R5646:Olfr432 UTSW 1 174051287 nonsense probably null
R6178:Olfr432 UTSW 1 174050967 missense probably benign 0.00
R6634:Olfr432 UTSW 1 174050969 missense probably benign 0.11
R7578:Olfr432 UTSW 1 174050700 missense possibly damaging 0.71
R7653:Olfr432 UTSW 1 174050922 missense probably benign 0.36
R8110:Olfr432 UTSW 1 174050525 missense probably benign 0.01
R8426:Olfr432 UTSW 1 174050580 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCATGAGCAGACAGGTAC -3'
(R):5'- TCAGCTCGAATCTCTGGTGG -3'

Sequencing Primer
(F):5'- TACAGAAACAGTTAGTTGGGGTTAC -3'
(R):5'- TGGGCCCACATAGACAATG -3'
Posted On2019-12-04