Incidental Mutation 'RF014:Uckl1'
ID603388
Institutional Source Beutler Lab
Gene Symbol Uckl1
Ensembl Gene ENSMUSG00000089917
Gene Nameuridine-cytidine kinase 1-like 1
SynonymsUrkl1, 1110007H10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #RF014 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181569149-181584892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181570194 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 373 (D373G)
Ref Sequence ENSEMBL: ENSMUSP00000050398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057816] [ENSMUST00000129469] [ENSMUST00000131949] [ENSMUST00000136875] [ENSMUST00000154613]
Predicted Effect probably benign
Transcript: ENSMUST00000057816
AA Change: D373G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050398
Gene: ENSMUSG00000089917
AA Change: D373G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 249 7e-10 PFAM
Pfam:PRK 100 288 5.7e-61 PFAM
Pfam:UPRTase 326 532 2.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129469
SMART Domains Protein: ENSMUSP00000121607
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 210 5.1e-10 PFAM
Pfam:AAA_17 100 251 1.1e-8 PFAM
Pfam:PRK 100 288 3.4e-60 PFAM
Pfam:AAA_18 101 257 5.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131949
Predicted Effect
SMART Domains Protein: ENSMUSP00000122098
Gene: ENSMUSG00000089917
AA Change: D27G

DomainStartEndE-ValueType
Pfam:UPRTase 1 182 9.8e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136875
SMART Domains Protein: ENSMUSP00000114821
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
Pfam:CPT 83 211 2.3e-10 PFAM
Pfam:AAA_17 85 235 4.9e-9 PFAM
Pfam:PRK 85 235 8.4e-47 PFAM
Pfam:AAA_18 86 235 2.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144856
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154613
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,857 probably benign Het
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACCGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Krtap28-10 CCACCACAGCCACAGCCACCACAGCCACAG CCACCACAGCCACAGACACCACAGCCACAGCCACCACAGCCACAG 1: 83,042,251 probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Map1a GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,295 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Thegl CAGCGATCCTCCCCAGTCCCGCA CAGCGATCCTCCCCAGTCCCGCAGGGCGAGCGATCCTCCCCAGTCCCGCA 5: 77,016,400 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Znrd1as CACCACCACCAC CACCACCACCACCACCACCACGACCACCACCAC 17: 36,965,060 probably benign Het
Other mutations in Uckl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Uckl1 APN 2 181569617 missense probably benign 0.09
IGL01128:Uckl1 APN 2 181570337 missense probably damaging 1.00
IGL01325:Uckl1 APN 2 181574961 nonsense probably null
IGL01767:Uckl1 APN 2 181569534 missense probably damaging 1.00
IGL02260:Uckl1 APN 2 181569588 missense probably damaging 1.00
IGL02390:Uckl1 APN 2 181574419 missense possibly damaging 0.59
IGL03369:Uckl1 APN 2 181570189 missense probably benign 0.00
R0001:Uckl1 UTSW 2 181574655 missense probably damaging 1.00
R0528:Uckl1 UTSW 2 181570490 splice site probably benign
R1037:Uckl1 UTSW 2 181572485 missense possibly damaging 0.67
R1355:Uckl1 UTSW 2 181573376 missense probably damaging 1.00
R1416:Uckl1 UTSW 2 181569569 missense possibly damaging 0.79
R1435:Uckl1 UTSW 2 181573133 missense probably benign 0.01
R1676:Uckl1 UTSW 2 181574918 missense probably damaging 1.00
R1723:Uckl1 UTSW 2 181570600 critical splice acceptor site probably null
R1954:Uckl1 UTSW 2 181570527 missense probably benign 0.17
R1955:Uckl1 UTSW 2 181570527 missense probably benign 0.17
R3972:Uckl1 UTSW 2 181574463 missense probably damaging 0.98
R4664:Uckl1 UTSW 2 181574868 missense possibly damaging 0.91
R4666:Uckl1 UTSW 2 181574868 missense possibly damaging 0.91
R5306:Uckl1 UTSW 2 181574367 critical splice donor site probably null
R5751:Uckl1 UTSW 2 181574452 missense possibly damaging 0.81
R5758:Uckl1 UTSW 2 181569953 missense probably damaging 1.00
R6174:Uckl1 UTSW 2 181573073 critical splice donor site probably null
R6662:Uckl1 UTSW 2 181573260 missense possibly damaging 0.87
R6865:Uckl1 UTSW 2 181574493 missense probably damaging 1.00
R7051:Uckl1 UTSW 2 181574244 missense probably damaging 1.00
R7643:Uckl1 UTSW 2 181573106 missense probably benign 0.08
R7818:Uckl1 UTSW 2 181574667 missense probably damaging 0.97
R8094:Uckl1 UTSW 2 181573256 missense probably damaging 1.00
R8341:Uckl1 UTSW 2 181569719 missense probably benign 0.00
R8515:Uckl1 UTSW 2 181574487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACGCAGAATTGACACG -3'
(R):5'- TTCTACCACCAGGGACAAGGAG -3'

Sequencing Primer
(F):5'- ACGCCGGTGATCTAGTGG -3'
(R):5'- CATCTTCTACTCCAAAAGACTGATG -3'
Posted On2019-12-04