Incidental Mutation 'RF014:Fndc5'
ID 603393
Institutional Source Beutler Lab
Gene Symbol Fndc5
Ensembl Gene ENSMUSG00000001334
Gene Name fibronectin type III domain containing 5
Synonyms 1500001L03Rik, PeP, Pxp
Accession Numbers

Genbank: NM_027402; MGI: 1917614  

Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # RF014 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 129136999-129144593 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129142167 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 199 (H199R)
Ref Sequence ENSEMBL: ENSMUSP00000099660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102600]
AlphaFold Q8K4Z2
Predicted Effect probably benign
Transcript: ENSMUST00000102600
AA Change: H199R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099660
Gene: ENSMUSG00000001334
AA Change: H199R

FN3 31 111 7.34e-9 SMART
Pfam:DUF4808 146 204 4.7e-10 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein containing fibronectin type III repeat. The encoded transmembrane protein undergoes proteolytic processing to generate a soluble hormone named irisin that is secreted into the bloodstream. The expression of this gene followed by the secretion of irisin from skeletal muscle is induced by exercise. The ectopic expression of the encoded protein in mice causes an elevation of irisin in blood and improves metabolic health. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Other mutations in Fndc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Fndc5 APN 4 129139446 missense probably damaging 1.00
IGL03336:Fndc5 APN 4 129139918 missense probably benign 0.00
N/A - 287:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
R0645:Fndc5 UTSW 4 129139837 splice site probably benign
R1202:Fndc5 UTSW 4 129139445 missense probably damaging 0.97
R3962:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R4408:Fndc5 UTSW 4 129142529 splice site probably null
R5379:Fndc5 UTSW 4 129142094 missense probably damaging 1.00
R5539:Fndc5 UTSW 4 129138721 missense probably damaging 1.00
R6242:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R6951:Fndc5 UTSW 4 129138780 missense possibly damaging 0.77
R7027:Fndc5 UTSW 4 129139523 missense probably benign 0.00
R7112:Fndc5 UTSW 4 129142122 missense probably benign 0.09
R8254:Fndc5 UTSW 4 129138721 missense possibly damaging 0.86
R8947:Fndc5 UTSW 4 129137136 missense probably benign 0.04
Z31818:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04