Incidental Mutation 'RF014:Zfp384'
ID603403
Institutional Source Beutler Lab
Gene Symbol Zfp384
Ensembl Gene ENSMUSG00000038346
Gene Namezinc finger protein 384
SynonymsC130073D16Rik, Nmp4, Ciz
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #RF014 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location125009145-125037870 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CC to CCAAGGCCCAGGAC at 125036466 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032480] [ENSMUST00000046064] [ENSMUST00000054553] [ENSMUST00000084275] [ENSMUST00000088308] [ENSMUST00000112417] [ENSMUST00000112424] [ENSMUST00000112425] [ENSMUST00000112427] [ENSMUST00000112428] [ENSMUST00000140131]
Predicted Effect probably benign
Transcript: ENSMUST00000032480
SMART Domains Protein: ENSMUSP00000032480
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 5.5e-35 PFAM
low complexity region 118 131 N/A INTRINSIC
PHD 197 242 3.67e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046064
SMART Domains Protein: ENSMUSP00000037986
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054553
SMART Domains Protein: ENSMUSP00000086354
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 174 196 7.26e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 230 252 1.95e-3 SMART
ZnF_C2H2 258 282 7.37e-4 SMART
ZnF_C2H2 288 310 5.06e-2 SMART
ZnF_C2H2 318 340 3.44e-4 SMART
low complexity region 346 404 N/A INTRINSIC
low complexity region 405 410 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084275
SMART Domains Protein: ENSMUSP00000081296
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088308
SMART Domains Protein: ENSMUSP00000085648
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112417
SMART Domains Protein: ENSMUSP00000108036
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 6.5e-35 PFAM
low complexity region 118 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112424
SMART Domains Protein: ENSMUSP00000108043
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 172 183 N/A INTRINSIC
ZnF_C2H2 213 235 7.26e-3 SMART
ZnF_C2H2 241 263 2.99e-4 SMART
ZnF_C2H2 269 291 1.95e-3 SMART
ZnF_C2H2 302 324 7.37e-4 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 382 7.37e-4 SMART
ZnF_C2H2 388 410 5.06e-2 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
low complexity region 446 504 N/A INTRINSIC
low complexity region 505 510 N/A INTRINSIC
low complexity region 513 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112425
SMART Domains Protein: ENSMUSP00000108044
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 313 337 7.37e-4 SMART
ZnF_C2H2 343 365 5.06e-2 SMART
ZnF_C2H2 373 395 3.44e-4 SMART
low complexity region 401 459 N/A INTRINSIC
low complexity region 460 465 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112427
SMART Domains Protein: ENSMUSP00000108046
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112428
SMART Domains Protein: ENSMUSP00000108047
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140131
SMART Domains Protein: ENSMUSP00000121519
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 6 107 2.1e-35 PFAM
low complexity region 114 139 N/A INTRINSIC
PHD 198 243 3.67e-12 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein, which may function as a transcription factor. This gene also contains long CAG trinucleotide repeats that encode consecutive glutamine residues. The protein appears to bind and regulate the promoters of the extracellular matrix genes MMP1, MMP3, MMP7 and COL1A1. Studies in mouse suggest that nuclear matrix transcription factors (NP/NMP4) may be part of a general mechanical pathway that couples cell construction and function during extracellular matrix remodeling. Alternative splicing results in multiple transcript variants. Recurrent rearrangements of this gene with the Ewing's sarcoma gene, EWSR1 on chromosome 22, or with the TAF15 gene on chromosome 17, or with the TCF3 (E2A) gene on chromosome 19, have been observed in acute leukemia. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mice are small and males have a small testis. Some males develop infertility and exhibit variable degrees of spermatogenic cell degeneration within the seminiferous tubules and increased apoptosis of spermatogenic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,857 probably benign Het
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACCGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Krtap28-10 CCACCACAGCCACAGCCACCACAGCCACAG CCACCACAGCCACAGACACCACAGCCACAGCCACCACAGCCACAG 1: 83,042,251 probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Map1a GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,295 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Thegl CAGCGATCCTCCCCAGTCCCGCA CAGCGATCCTCCCCAGTCCCGCAGGGCGAGCGATCCTCCCCAGTCCCGCA 5: 77,016,400 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Znrd1as CACCACCACCAC CACCACCACCACCACCACCACGACCACCACCAC 17: 36,965,060 probably benign Het
Other mutations in Zfp384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Zfp384 APN 6 125025053 missense probably benign 0.03
IGL01568:Zfp384 APN 6 125024132 missense probably damaging 1.00
IGL01632:Zfp384 APN 6 125024761 missense probably damaging 1.00
IGL03408:Zfp384 APN 6 125035713 missense probably damaging 1.00
FR4304:Zfp384 UTSW 6 125036493 unclassified probably benign
FR4340:Zfp384 UTSW 6 125036463 unclassified probably benign
R0839:Zfp384 UTSW 6 125036668 missense probably benign 0.01
R1370:Zfp384 UTSW 6 125036453 missense probably benign 0.04
R1427:Zfp384 UTSW 6 125024884 missense probably damaging 1.00
R2441:Zfp384 UTSW 6 125036649 missense probably benign 0.01
R2986:Zfp384 UTSW 6 125024896 missense possibly damaging 0.78
R4003:Zfp384 UTSW 6 125033237 splice site probably benign
R4833:Zfp384 UTSW 6 125030848 missense probably damaging 1.00
R4860:Zfp384 UTSW 6 125030930 synonymous silent
R5084:Zfp384 UTSW 6 125023679 splice site probably benign
R5137:Zfp384 UTSW 6 125036509 unclassified probably benign
R5449:Zfp384 UTSW 6 125024138 missense probably damaging 1.00
R5558:Zfp384 UTSW 6 125036509 unclassified probably benign
R5720:Zfp384 UTSW 6 125036624 missense probably benign 0.19
R5849:Zfp384 UTSW 6 125024099 missense possibly damaging 0.91
R5961:Zfp384 UTSW 6 125024034 missense probably damaging 1.00
R6165:Zfp384 UTSW 6 125024933 splice site probably null
R6948:Zfp384 UTSW 6 125024910 missense probably benign 0.08
R7106:Zfp384 UTSW 6 125024259 missense probably benign 0.23
R7192:Zfp384 UTSW 6 125033312 missense probably damaging 1.00
R7320:Zfp384 UTSW 6 125024830 missense possibly damaging 0.92
R7730:Zfp384 UTSW 6 125031672 missense probably benign 0.02
R7861:Zfp384 UTSW 6 125036325 missense probably damaging 1.00
R8080:Zfp384 UTSW 6 125036558 missense unknown
RF002:Zfp384 UTSW 6 125036471 unclassified probably benign
RF003:Zfp384 UTSW 6 125036471 unclassified probably benign
RF003:Zfp384 UTSW 6 125036476 unclassified probably benign
RF003:Zfp384 UTSW 6 125036483 unclassified probably benign
RF010:Zfp384 UTSW 6 125036471 unclassified probably benign
RF010:Zfp384 UTSW 6 125036488 unclassified probably benign
RF011:Zfp384 UTSW 6 125036476 unclassified probably benign
RF015:Zfp384 UTSW 6 125036481 unclassified probably benign
RF018:Zfp384 UTSW 6 125036489 unclassified probably benign
RF020:Zfp384 UTSW 6 125036455 unclassified probably benign
RF020:Zfp384 UTSW 6 125036488 unclassified probably benign
RF022:Zfp384 UTSW 6 125036471 unclassified probably benign
RF024:Zfp384 UTSW 6 125036489 unclassified probably benign
RF026:Zfp384 UTSW 6 125036492 unclassified probably benign
RF027:Zfp384 UTSW 6 125036490 unclassified probably benign
RF030:Zfp384 UTSW 6 125036483 unclassified probably benign
RF056:Zfp384 UTSW 6 125036490 unclassified probably benign
RF057:Zfp384 UTSW 6 125036496 unclassified probably benign
RF062:Zfp384 UTSW 6 125036466 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TAAGAGCCCAGGTTGAGACTTG -3'
(R):5'- ATGCTCTGCCGGCTTATAGG -3'

Sequencing Primer
(F):5'- CCAGGTTGAGACTTGCAGGTTG -3'
(R):5'- CCGGCTTATAGGGGGTCAAGTC -3'
Posted On2019-12-04