Incidental Mutation 'RF014:Setd1a'
ID 603408
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF014 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) TGGTGGTGG to TGGTGGTGGGGGTGGTGG at 127384518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
AlphaFold E9PYH6
Predicted Effect probably benign
Transcript: ENSMUST00000047075
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,820 (GRCm39) probably benign Het
A2ml1 T C 6: 128,547,031 (GRCm39) N366S probably damaging Het
Abca5 T C 11: 110,170,580 (GRCm39) probably null Het
Acaca T C 11: 84,122,550 (GRCm39) V323A probably benign Het
Agbl3 T A 6: 34,776,293 (GRCm39) D266E possibly damaging Het
Aggf1 A T 13: 95,507,276 (GRCm39) S170T possibly damaging Het
Amhr2 A T 15: 102,361,589 (GRCm39) S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 108,999,348 (GRCm39) probably benign Het
Best3 A T 10: 116,840,410 (GRCm39) Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,129,704 (GRCm39) probably benign Het
Ccdc186 A G 19: 56,801,904 (GRCm39) L71S probably benign Het
Ces1d C A 8: 93,902,793 (GRCm39) probably null Het
Chga AGC AGCGGC 12: 102,527,652 (GRCm39) probably benign Het
Chga AGC AGCTGC 12: 102,527,664 (GRCm39) probably benign Het
Clstn3 T A 6: 124,436,225 (GRCm39) K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 129,986,860 (GRCm39) probably benign Het
Cpxm2 G T 7: 131,672,592 (GRCm39) T319K possibly damaging Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACCGCCCAGGGATGTGACAGACACAC 9: 86,922,468 (GRCm39) probably benign Het
Dst T C 1: 34,286,760 (GRCm39) S3364P probably benign Het
Edc4 C T 8: 106,611,232 (GRCm39) T61M probably benign Het
Fndc5 A G 4: 129,035,960 (GRCm39) H199R probably benign Het
Gm43302 T A 5: 105,422,623 (GRCm39) I470F possibly damaging Het
Gne G T 4: 44,060,045 (GRCm39) A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,812,270 (GRCm39) probably benign Het
Irf9 C T 14: 55,843,334 (GRCm39) R179* probably null Het
Jakmip1 A T 5: 37,331,870 (GRCm39) K850M possibly damaging Het
Kalrn G A 16: 33,860,303 (GRCm39) T1884I probably benign Het
Krtap28-10 CCACCACAGCCACAGCCACCACAGCCACAG CCACCACAGCCACAGACACCACAGCCACAGCCACCACAGCCACAG 1: 83,019,972 (GRCm39) probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 94,984,263 (GRCm39) probably benign Het
Lctl A G 9: 64,026,212 (GRCm39) Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,450,665 (GRCm39) probably benign Het
Luzp2 A T 7: 54,821,953 (GRCm39) I157F probably damaging Het
Lyz3 A G 10: 117,070,322 (GRCm39) *152Q probably null Het
Mamld1 GCA GCACCA X: 70,162,451 (GRCm39) probably benign Het
Map1a GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 121,136,776 (GRCm39) probably benign Het
Mbd3l1 A T 9: 18,396,296 (GRCm39) E140D possibly damaging Het
Mlh3 T A 12: 85,314,803 (GRCm39) Q461L probably benign Het
Mto1 G T 9: 78,355,598 (GRCm39) R7L probably benign Het
Muc4 A T 16: 32,570,676 (GRCm39) S579C probably damaging Het
Ngfr T C 11: 95,469,027 (GRCm39) Y117C probably damaging Het
Or10aa3 A T 1: 173,878,553 (GRCm39) I205F possibly damaging Het
Or13a23-ps1 A T 7: 140,118,690 (GRCm39) M87L probably benign Het
Or8d2b C A 9: 38,789,196 (GRCm39) H241Q probably benign Het
Plch2 A G 4: 155,091,577 (GRCm39) S179P probably damaging Het
Pogz T G 3: 94,785,558 (GRCm39) S838A possibly damaging Het
Polr1has CACCACCACCAC CACCACCACCACCACCACCACGACCACCACCAC 17: 37,275,952 (GRCm39) probably benign Het
Pot1b T A 17: 55,981,106 (GRCm39) T303S probably benign Het
Pou2f2 T A 7: 24,815,162 (GRCm39) I72L unknown Het
Ptpn4 A G 1: 119,612,195 (GRCm39) probably null Het
Ptprs A T 17: 56,723,935 (GRCm39) I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,694,353 (GRCm39) probably benign Het
Rnf14 T A 18: 38,442,623 (GRCm39) V308E probably damaging Het
Sgo2b T C 8: 64,384,439 (GRCm39) T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,928,784 (GRCm39) probably benign Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Spmap2l CAGCGATCCTCCCCAGTCCCGCA CAGCGATCCTCCCCAGTCCCGCAGGGCGAGCGATCCTCCCCAGTCCCGCA 5: 77,164,247 (GRCm39) probably benign Het
Stox1 T A 10: 62,500,025 (GRCm39) H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,086 (GRCm39) probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,673,132 (GRCm39) probably benign Het
Trim33 T C 3: 103,236,408 (GRCm39) V506A possibly damaging Het
Uckl1 T C 2: 181,211,987 (GRCm39) D373G probably benign Het
Vmn2r94 G T 17: 18,473,549 (GRCm39) C492* probably null Het
Wdr33 A G 18: 32,014,326 (GRCm39) D396G probably damaging Het
Ypel1 C T 16: 16,915,282 (GRCm39) V109M probably damaging Het
Zbtb11 A T 16: 55,800,960 (GRCm39) I105L probably damaging Het
Zbtb40 A T 4: 136,744,617 (GRCm39) C268S probably benign Het
Zfp36l1 T A 12: 80,156,518 (GRCm39) M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,013,429 (GRCm39) probably benign Het
Zfp87 A G 13: 74,523,173 (GRCm39) F15S probably benign Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATCGTTACCAGCGCCATAC -3'
(R):5'- GAGCGTTGTTCCTTCAGCAG -3'

Sequencing Primer
(F):5'- GCAACTAGAGAGGACCCTTCTG -3'
(R):5'- CTTCAGCAGCATTTCAATACGGG -3'
Posted On 2019-12-04