Incidental Mutation 'RF014:Cpxm2'
ID 603409
Institutional Source Beutler Lab
Gene Symbol Cpxm2
Ensembl Gene ENSMUSG00000030862
Gene Name carboxypeptidase X 2 (M14 family)
Synonyms 4632435C11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # RF014 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 132032687-132154739 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 132070863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 319 (T319K)
Ref Sequence ENSEMBL: ENSMUSP00000033149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033149] [ENSMUST00000124096]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000033149
AA Change: T319K

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033149
Gene: ENSMUSG00000030862
AA Change: T319K

signal peptide 1 27 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
FA58C 143 301 2.18e-46 SMART
Zn_pept 448 736 9.21e-58 SMART
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Other mutations in Cpxm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Cpxm2 APN 7 132059811 missense probably benign 0.01
IGL02039:Cpxm2 APN 7 132047753 missense probably damaging 1.00
IGL03011:Cpxm2 APN 7 132049078 missense possibly damaging 0.46
R0033:Cpxm2 UTSW 7 132062157 missense possibly damaging 0.55
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0453:Cpxm2 UTSW 7 132128405 missense probably damaging 1.00
R0555:Cpxm2 UTSW 7 132044043 nonsense probably null
R0655:Cpxm2 UTSW 7 132054820 missense possibly damaging 0.87
R0834:Cpxm2 UTSW 7 132154613 intron probably benign
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1249:Cpxm2 UTSW 7 132128350 critical splice donor site probably null
R1563:Cpxm2 UTSW 7 132143682 missense probably benign 0.00
R1565:Cpxm2 UTSW 7 132062145 missense probably damaging 1.00
R1709:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1863:Cpxm2 UTSW 7 132143663 splice site probably null
R1874:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1958:Cpxm2 UTSW 7 132062147 missense probably damaging 1.00
R2273:Cpxm2 UTSW 7 132059852 intron probably benign
R3806:Cpxm2 UTSW 7 132080091 missense probably benign 0.12
R3861:Cpxm2 UTSW 7 132054919 missense probably benign 0.00
R4570:Cpxm2 UTSW 7 132143706 missense probably benign 0.11
R4642:Cpxm2 UTSW 7 132070881 missense probably benign 0.11
R4684:Cpxm2 UTSW 7 132049038 missense possibly damaging 0.92
R4717:Cpxm2 UTSW 7 132054845 missense possibly damaging 0.61
R4863:Cpxm2 UTSW 7 132059747 missense probably benign 0.13
R5079:Cpxm2 UTSW 7 132154285 critical splice donor site probably null
R5341:Cpxm2 UTSW 7 132154613 intron probably benign
R5626:Cpxm2 UTSW 7 132059852 intron probably benign
R5666:Cpxm2 UTSW 7 132054896 missense probably benign 0.44
R5815:Cpxm2 UTSW 7 132044110 missense probably damaging 1.00
R6114:Cpxm2 UTSW 7 132154306 missense probably benign
R6133:Cpxm2 UTSW 7 132128453 missense probably damaging 1.00
R6224:Cpxm2 UTSW 7 132143731 missense probably benign
R6468:Cpxm2 UTSW 7 132070860 missense probably damaging 1.00
R6657:Cpxm2 UTSW 7 132049077 missense probably damaging 1.00
R7058:Cpxm2 UTSW 7 132143679 missense probably benign 0.32
R7100:Cpxm2 UTSW 7 132054815 missense probably benign 0.06
R7198:Cpxm2 UTSW 7 132080084 missense probably damaging 1.00
R7712:Cpxm2 UTSW 7 132154378 missense possibly damaging 0.69
R7855:Cpxm2 UTSW 7 132057695 missense possibly damaging 0.56
R7867:Cpxm2 UTSW 7 132049071 missense probably damaging 1.00
R8513:Cpxm2 UTSW 7 132143702 missense probably benign 0.01
R8694:Cpxm2 UTSW 7 132080054 missense probably benign 0.03
R8874:Cpxm2 UTSW 7 132106281 critical splice donor site probably null
R8967:Cpxm2 UTSW 7 132059835 missense probably damaging 1.00
Z1177:Cpxm2 UTSW 7 132055001 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04