Incidental Mutation 'RF014:Ces1d'
Institutional Source Beutler Lab
Gene Symbol Ces1d
Ensembl Gene ENSMUSG00000056973
Gene Namecarboxylesterase 1D
SynonymsTGH, Ces3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF014 (G1)
Quality Score225.009
Status Validated
Chromosomal Location93166068-93197838 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 93176165 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034172]
Predicted Effect probably null
Transcript: ENSMUST00000034172
SMART Domains Protein: ENSMUSP00000034172
Gene: ENSMUSG00000056973

Pfam:COesterase 1 545 4.9e-169 PFAM
Pfam:Abhydrolase_3 136 256 8.1e-11 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased blood lipids, improved glucose tolerance, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Other mutations in Ces1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Ces1d APN 8 93195089 splice site probably benign
IGL01707:Ces1d APN 8 93189550 missense possibly damaging 0.57
IGL01753:Ces1d APN 8 93192810 missense probably damaging 1.00
IGL01918:Ces1d APN 8 93178075 missense probably benign 0.00
IGL02730:Ces1d APN 8 93186016 missense probably benign
IGL02819:Ces1d APN 8 93169718 splice site probably null
IGL02824:Ces1d APN 8 93169718 splice site probably null
IGL02825:Ces1d APN 8 93169718 splice site probably null
IGL02858:Ces1d APN 8 93169718 splice site probably null
IGL02877:Ces1d APN 8 93169718 splice site probably null
IGL02946:Ces1d APN 8 93169718 splice site probably null
IGL02990:Ces1d APN 8 93169718 splice site probably null
IGL03024:Ces1d APN 8 93169718 splice site probably null
IGL03080:Ces1d APN 8 93169718 splice site probably null
IGL03081:Ces1d APN 8 93169718 splice site probably null
IGL03082:Ces1d APN 8 93169718 splice site probably null
IGL03096:Ces1d APN 8 93178042 missense probably benign 0.01
IGL03165:Ces1d APN 8 93189519 missense probably benign 0.02
IGL03233:Ces1d APN 8 93195079 missense probably benign
IGL03263:Ces1d APN 8 93169718 splice site probably null
IGL03310:Ces1d APN 8 93175188 splice site probably benign
IGL03338:Ces1d APN 8 93169718 splice site probably null
IGL03357:Ces1d APN 8 93169718 splice site probably null
R0125:Ces1d UTSW 8 93175182 splice site probably benign
R0393:Ces1d UTSW 8 93192772 missense probably damaging 1.00
R0483:Ces1d UTSW 8 93197679 missense probably benign
R0746:Ces1d UTSW 8 93189468 missense probably damaging 1.00
R1470:Ces1d UTSW 8 93195021 missense possibly damaging 0.50
R1470:Ces1d UTSW 8 93195021 missense possibly damaging 0.50
R1607:Ces1d UTSW 8 93186118 missense probably benign 0.08
R1879:Ces1d UTSW 8 93189498 missense probably benign 0.35
R2881:Ces1d UTSW 8 93195031 missense probably damaging 1.00
R3870:Ces1d UTSW 8 93175086 missense probably benign 0.15
R4004:Ces1d UTSW 8 93178092 missense probably benign 0.03
R4573:Ces1d UTSW 8 93181534 missense probably benign 0.00
R4647:Ces1d UTSW 8 93166410 missense probably damaging 1.00
R4985:Ces1d UTSW 8 93175144 missense possibly damaging 0.61
R5080:Ces1d UTSW 8 93181547 missense probably benign 0.02
R5209:Ces1d UTSW 8 93175188 splice site probably benign
R5351:Ces1d UTSW 8 93178078 missense probably damaging 1.00
R5433:Ces1d UTSW 8 93186036 missense probably benign 0.02
R5614:Ces1d UTSW 8 93176204 missense probably benign 0.00
R5722:Ces1d UTSW 8 93178128 missense probably benign 0.01
R6257:Ces1d UTSW 8 93166397 missense probably benign 0.03
R7238:Ces1d UTSW 8 93178135 missense probably benign 0.01
R7410:Ces1d UTSW 8 93192805 missense probably damaging 1.00
R7489:Ces1d UTSW 8 93178131 missense probably damaging 1.00
R7563:Ces1d UTSW 8 93178039 missense probably benign 0.25
R7827:Ces1d UTSW 8 93197666 critical splice donor site probably null
R7853:Ces1d UTSW 8 93175067 missense probably benign 0.29
R7860:Ces1d UTSW 8 93171137 missense probably benign 0.08
R8202:Ces1d UTSW 8 93192867 missense probably benign 0.08
R8282:Ces1d UTSW 8 93186112 missense possibly damaging 0.83
R8968:Ces1d UTSW 8 93187755 missense probably damaging 1.00
R8981:Ces1d UTSW 8 93192829 missense probably benign 0.00
Z1088:Ces1d UTSW 8 93175108 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04