Incidental Mutation 'RF014:Six4'
ID603426
Institutional Source Beutler Lab
Gene Symbol Six4
Ensembl Gene ENSMUSG00000034460
Gene Namesine oculis-related homeobox 4
SynonymsTrexBF, AREC3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF014 (G1)
Quality Score217.468
Status Validated
Chromosome12
Chromosomal Location73099609-73113456 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to T at 73103582 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043208] [ENSMUST00000175693]
Predicted Effect probably null
Transcript: ENSMUST00000043208
SMART Domains Protein: ENSMUSP00000036150
Gene: ENSMUSG00000034460

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
low complexity region 57 80 N/A INTRINSIC
low complexity region 89 98 N/A INTRINSIC
Pfam:SIX1_SD 101 211 1.6e-47 PFAM
HOX 216 278 7.48e-17 SMART
low complexity region 335 348 N/A INTRINSIC
low complexity region 365 378 N/A INTRINSIC
low complexity region 424 437 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175693
SMART Domains Protein: ENSMUSP00000135699
Gene: ENSMUSG00000034460

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 49 72 N/A INTRINSIC
low complexity region 81 90 N/A INTRINSIC
HOX 208 270 7.48e-17 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeobox family, subfamily SIX. The drosophila homolog is a nuclear homeoprotein required for eye development. Studies in mouse show that this gene product functions as a transcription factor, and may have a role in the differentiation or maturation of neuronal cells. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for a targeted null mutation are viable, fertile, and exhibit no apparent abnormalities suggesting compensation by other Six family members. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,857 probably benign Het
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACCGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Krtap28-10 CCACCACAGCCACAGCCACCACAGCCACAG CCACCACAGCCACAGACACCACAGCCACAGCCACCACAGCCACAG 1: 83,042,251 probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Map1a GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,295 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Thegl CAGCGATCCTCCCCAGTCCCGCA CAGCGATCCTCCCCAGTCCCGCAGGGCGAGCGATCCTCCCCAGTCCCGCA 5: 77,016,400 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Znrd1as CACCACCACCAC CACCACCACCACCACCACCACGACCACCACCAC 17: 36,965,060 probably benign Het
Other mutations in Six4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Six4 APN 12 73109197 missense probably benign 0.32
IGL02045:Six4 APN 12 73108655 missense probably benign 0.04
IGL02678:Six4 APN 12 73112634 missense probably damaging 1.00
R2473:Six4 UTSW 12 73104175 missense probably benign 0.00
R3409:Six4 UTSW 12 73112883 missense probably damaging 0.98
R3410:Six4 UTSW 12 73112883 missense probably damaging 0.98
R3411:Six4 UTSW 12 73112883 missense probably damaging 0.98
R4175:Six4 UTSW 12 73108831 missense probably damaging 1.00
R4176:Six4 UTSW 12 73108831 missense probably damaging 1.00
R4296:Six4 UTSW 12 73104125 missense probably damaging 1.00
R4303:Six4 UTSW 12 73112540 missense possibly damaging 0.91
R5013:Six4 UTSW 12 73103626 missense probably benign 0.37
R5782:Six4 UTSW 12 73104058 missense probably benign 0.02
R5794:Six4 UTSW 12 73112350 missense possibly damaging 0.82
R6429:Six4 UTSW 12 73103473 missense probably damaging 1.00
R6650:Six4 UTSW 12 73103525 missense probably benign 0.04
R7018:Six4 UTSW 12 73108953 missense probably benign 0.01
R7464:Six4 UTSW 12 73112530 missense possibly damaging 0.89
R7832:Six4 UTSW 12 73112634 missense probably damaging 1.00
R7871:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7872:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7873:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7956:Six4 UTSW 12 73103761 missense possibly damaging 0.83
R8266:Six4 UTSW 12 73108649 missense possibly damaging 0.53
RF012:Six4 UTSW 12 73103582 frame shift probably null
RF013:Six4 UTSW 12 73103582 frame shift probably null
RF015:Six4 UTSW 12 73103582 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCTCCTGTTAAAGCAGAGAAGG -3'
(R):5'- TGCAACCCTTCAGAACTGTTC -3'

Sequencing Primer
(F):5'- GAGGGATGTGGAGTGAATCG -3'
(R):5'- ATTCCGGGGCAAGACCTATTGTC -3'
Posted On2019-12-04