Incidental Mutation 'RF014:Ppil2'
Institutional Source Beutler Lab
Gene Symbol Ppil2
Ensembl Gene ENSMUSG00000022771
Gene Namepeptidylprolyl isomerase (cyclophilin)-like 2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF014 (G1)
Quality Score225.009
Status Validated
Chromosomal Location17086555-17111257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17097418 bp
Amino Acid Change Valine to Methionine at position 109 (V109M)
Ref Sequence ENSEMBL: ENSMUSP00000023455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023455] [ENSMUST00000164458] [ENSMUST00000231245] [ENSMUST00000231451] [ENSMUST00000231712] [ENSMUST00000232481]
Predicted Effect probably damaging
Transcript: ENSMUST00000023455
AA Change: V109M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023455
Gene: ENSMUSG00000022771
AA Change: V109M

Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164458
AA Change: V109M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131422
Gene: ENSMUSG00000022771
AA Change: V109M

Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231245
AA Change: V109M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000231451
AA Change: V109M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231712
AA Change: V109M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232481
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. This protein interacts with the proteinase inhibitor eglin c and is localized in the nucleus. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Other mutations in Ppil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ppil2 APN 16 17091212 missense probably damaging 1.00
IGL02392:Ppil2 APN 16 17088838 missense probably benign
IGL02559:Ppil2 APN 16 17109651 missense possibly damaging 0.80
IGL02708:Ppil2 APN 16 17106008 missense probably benign 0.03
IGL02724:Ppil2 APN 16 17103602 missense probably benign 0.08
zagnut UTSW 16 17096041 missense possibly damaging 0.62
R0592:Ppil2 UTSW 16 17107219 missense probably benign
R0975:Ppil2 UTSW 16 17107213 missense probably benign 0.00
R1258:Ppil2 UTSW 16 17106053 missense probably damaging 1.00
R1677:Ppil2 UTSW 16 17103610 missense probably damaging 1.00
R1728:Ppil2 UTSW 16 17089419 unclassified probably benign
R1739:Ppil2 UTSW 16 17089419 unclassified probably benign
R1784:Ppil2 UTSW 16 17089419 unclassified probably benign
R1853:Ppil2 UTSW 16 17107223 missense probably benign 0.00
R3608:Ppil2 UTSW 16 17092290 nonsense probably null
R3769:Ppil2 UTSW 16 17109668 missense probably benign 0.30
R4445:Ppil2 UTSW 16 17103600 nonsense probably null
R4518:Ppil2 UTSW 16 17096041 missense possibly damaging 0.62
R5066:Ppil2 UTSW 16 17109675 missense probably benign 0.03
R5842:Ppil2 UTSW 16 17094987 missense possibly damaging 0.66
R6013:Ppil2 UTSW 16 17100265 missense probably damaging 1.00
R6415:Ppil2 UTSW 16 17103574 critical splice donor site probably null
R7735:Ppil2 UTSW 16 17100260 missense probably benign 0.11
X0010:Ppil2 UTSW 16 17095037 missense possibly damaging 0.54
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04