Incidental Mutation 'RF014:Kalrn'
ID 603439
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms 2210407G14Rik, Hapip, E530005C20Rik, LOC224126
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock # RF014 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 33969073-34573532 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34039933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1884 (T1884I)
Ref Sequence ENSEMBL: ENSMUSP00000076088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114963] [ENSMUST00000114964] [ENSMUST00000114966] [ENSMUST00000114973] [ENSMUST00000232157]
AlphaFold no structure available at present
PDB Structure Solution structure of SH3 domain of mouse Kalirin-9a protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000076810
AA Change: T1884I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: T1884I

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114963
AA Change: T253I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110614
Gene: ENSMUSG00000061751
AA Change: T253I

DomainStartEndE-ValueType
SH3 22 83 1.23e-7 SMART
RhoGEF 273 443 1.47e-52 SMART
PH 463 568 9.87e-4 SMART
SH3 664 725 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114964
AA Change: T184I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000110615
Gene: ENSMUSG00000061751
AA Change: T184I

DomainStartEndE-ValueType
RhoGEF 204 374 1.47e-52 SMART
PH 394 499 9.87e-4 SMART
SH3 595 656 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114966
AA Change: T215I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110617
Gene: ENSMUSG00000061751
AA Change: T215I

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114973
AA Change: T215I

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: T215I

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: T1879I

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232157
AA Change: T184I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,857 probably benign Het
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACCGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Krtap28-10 CCACCACAGCCACAGCCACCACAGCCACAG CCACCACAGCCACAGACACCACAGCCACAGCCACCACAGCCACAG 1: 83,042,251 probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Map1a GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,295 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Thegl CAGCGATCCTCCCCAGTCCCGCA CAGCGATCCTCCCCAGTCCCGCAGGGCGAGCGATCCTCCCCAGTCCCGCA 5: 77,016,400 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Znrd1as CACCACCACCAC CACCACCACCACCACCACCACGACCACCACCAC 17: 36,965,060 probably benign Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
ethereal UTSW 16 33975435 utr 3 prime probably benign
Hidden UTSW 16 34027976 missense probably damaging 1.00
Soulful UTSW 16 34187484 nonsense probably null
G1Funyon:Kalrn UTSW 16 34357100 missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 splice site probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
R7612:Kalrn UTSW 16 34314212 missense possibly damaging 0.68
R7772:Kalrn UTSW 16 34031582 missense probably benign 0.04
R7796:Kalrn UTSW 16 34187484 nonsense probably null
R7867:Kalrn UTSW 16 33989791 missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33988847 missense probably damaging 0.98
R7914:Kalrn UTSW 16 34028752 missense probably benign
R8080:Kalrn UTSW 16 33975668 missense possibly damaging 0.83
R8147:Kalrn UTSW 16 34055044 missense probably benign
R8239:Kalrn UTSW 16 34049783 missense noncoding transcript
R8281:Kalrn UTSW 16 34035061 nonsense probably null
R8294:Kalrn UTSW 16 34033584 missense probably benign 0.12
R8301:Kalrn UTSW 16 34357100 missense probably benign 0.05
R8686:Kalrn UTSW 16 34360935 missense probably damaging 1.00
R8693:Kalrn UTSW 16 34034514 missense probably damaging 1.00
R8798:Kalrn UTSW 16 33982855 missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34198460 missense probably benign 0.05
R8878:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R8880:Kalrn UTSW 16 34217935 missense probably damaging 1.00
R8883:Kalrn UTSW 16 33993655 missense probably damaging 1.00
R8887:Kalrn UTSW 16 34227126 missense probably benign 0.22
R9048:Kalrn UTSW 16 34034484 missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34361001 missense probably damaging 0.96
R9317:Kalrn UTSW 16 34013675 missense
R9424:Kalrn UTSW 16 33988818 missense probably benign 0.06
R9442:Kalrn UTSW 16 34095879 start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33985230 missense probably benign 0.13
Z1177:Kalrn UTSW 16 34035506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGCTTCCTTAAGGCAGTG -3'
(R):5'- TTCAGAGAGCACAGCCTTGG -3'

Sequencing Primer
(F):5'- GCAGTGCCAAAATGTTGTTCTG -3'
(R):5'- GCTGCTGGCCTTCCTATTG -3'
Posted On 2019-12-04