Incidental Mutation 'RF014:Pot1b'
Institutional Source Beutler Lab
Gene Symbol Pot1b
Ensembl Gene ENSMUSG00000024174
Gene Nameprotection of telomeres 1B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF014 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location55652025-55712628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55674106 bp
Amino Acid Change Threonine to Serine at position 303 (T303S)
Ref Sequence ENSEMBL: ENSMUSP00000084089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086876]
Predicted Effect probably benign
Transcript: ENSMUST00000086876
AA Change: T303S

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084089
Gene: ENSMUSG00000024174
AA Change: T303S

Telo_bind 11 141 1.74e-51 SMART
Pfam:POT1PC 152 299 7.9e-40 PFAM
low complexity region 313 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one null mutation display male infertility with age, male germ cell apoptosis, hyperpigmentation, increased apoptosis in intestinal crypts, and decreased body size. Mice homozygous for a transgenic gene disruption exhibit neonatal lethality with possible stem cell defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Other mutations in Pot1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Pot1b APN 17 55695160 missense possibly damaging 0.94
IGL01796:Pot1b APN 17 55669750 missense possibly damaging 0.53
IGL01810:Pot1b APN 17 55662521 missense possibly damaging 0.68
IGL02371:Pot1b APN 17 55695092 missense possibly damaging 0.91
IGL02553:Pot1b APN 17 55695024 splice site probably benign
IGL02957:Pot1b APN 17 55700009 missense probably damaging 0.99
IGL02975:Pot1b APN 17 55662454 splice site probably benign
IGL03172:Pot1b APN 17 55695206 missense possibly damaging 0.60
boulder UTSW 17 55672865 nonsense probably null
erosion UTSW 17 55687834 missense probably damaging 0.99
R0020:Pot1b UTSW 17 55653429 missense probably benign 0.03
R0540:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0607:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0882:Pot1b UTSW 17 55666400 splice site probably benign
R1164:Pot1b UTSW 17 55674085 missense probably benign 0.18
R1476:Pot1b UTSW 17 55653451 missense possibly damaging 0.73
R1874:Pot1b UTSW 17 55654805 missense probably benign
R1955:Pot1b UTSW 17 55674067 missense possibly damaging 0.73
R1960:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R1961:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R2109:Pot1b UTSW 17 55653413 missense probably benign 0.00
R2895:Pot1b UTSW 17 55687939 missense probably damaging 0.98
R2943:Pot1b UTSW 17 55674058 missense probably benign
R4681:Pot1b UTSW 17 55654831 missense probably benign 0.28
R4763:Pot1b UTSW 17 55695160 missense possibly damaging 0.94
R4821:Pot1b UTSW 17 55672885 missense possibly damaging 0.73
R5079:Pot1b UTSW 17 55669801 missense probably benign 0.18
R5146:Pot1b UTSW 17 55672865 nonsense probably null
R5176:Pot1b UTSW 17 55699995 missense probably benign 0.05
R5394:Pot1b UTSW 17 55700063 missense probably benign 0.19
R5752:Pot1b UTSW 17 55687834 missense probably damaging 0.99
R6866:Pot1b UTSW 17 55653474 missense possibly damaging 0.83
X0062:Pot1b UTSW 17 55695154 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04