Incidental Mutation 'RF014:Ptprs'
ID603444
Institutional Source Beutler Lab
Gene Symbol Ptprs
Ensembl Gene ENSMUSG00000013236
Gene Nameprotein tyrosine phosphatase, receptor type, S
SynonymsPtpt9, PTP-NU3, RPTPsigma, PTPsigma
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF014 (G1)
Quality Score120.008
Status Not validated
Chromosome17
Chromosomal Location56412426-56476483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56416935 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1686 (I1686N)
Ref Sequence ENSEMBL: ENSMUSP00000064048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223859]
PDB Structure
Crystal structure of mouse PTPsigma [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000067538
AA Change: I1686N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: I1686N

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 605 692 9.69e-9 SMART
FN3 707 796 2.42e-9 SMART
FN3 811 890 2.22e0 SMART
FN3 905 995 8.31e-8 SMART
FN3 1009 1085 3.22e-5 SMART
low complexity region 1164 1177 N/A INTRINSIC
transmembrane domain 1259 1281 N/A INTRINSIC
PTPc 1351 1609 1.54e-136 SMART
PTPc 1638 1900 3.12e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086828
AA Change: I1280N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: I1280N

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 603 679 2.54e-3 SMART
low complexity region 758 771 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
PTPc 945 1203 1.54e-136 SMART
PTPc 1232 1494 3.12e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223859
AA Change: I1276N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,857 probably benign Het
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACCGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Krtap28-10 CCACCACAGCCACAGCCACCACAGCCACAG CCACCACAGCCACAGACACCACAGCCACAGCCACCACAGCCACAG 1: 83,042,251 probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Map1a GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,295 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf14 T A 18: 38,309,570 V308E probably damaging Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Thegl CAGCGATCCTCCCCAGTCCCGCA CAGCGATCCTCCCCAGTCCCGCAGGGCGAGCGATCCTCCCCAGTCCCGCA 5: 77,016,400 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Znrd1as CACCACCACCAC CACCACCACCACCACCACCACGACCACCACCAC 17: 36,965,060 probably benign Het
Other mutations in Ptprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ptprs APN 17 56458243 missense probably damaging 0.99
IGL01388:Ptprs APN 17 56421261 missense probably damaging 1.00
IGL01568:Ptprs APN 17 56413958 missense probably damaging 1.00
IGL01781:Ptprs APN 17 56435676 missense probably damaging 1.00
IGL02499:Ptprs APN 17 56437884 missense probably damaging 1.00
IGL02576:Ptprs APN 17 56414958 missense probably damaging 1.00
IGL02736:Ptprs APN 17 56458248 missense possibly damaging 0.88
IGL02871:Ptprs APN 17 56447443 missense probably damaging 1.00
IGL02946:Ptprs APN 17 56424032 missense probably benign
IGL03061:Ptprs APN 17 56418830 missense probably damaging 0.96
IGL03347:Ptprs APN 17 56435972 missense probably benign 0.07
IGL03351:Ptprs APN 17 56437943 missense probably damaging 1.00
P0019:Ptprs UTSW 17 56447474 splice site probably benign
PIT4434001:Ptprs UTSW 17 56454984 missense probably null 0.02
PIT4520001:Ptprs UTSW 17 56414980 missense probably damaging 1.00
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0504:Ptprs UTSW 17 56454220 missense possibly damaging 0.60
R0518:Ptprs UTSW 17 56419621 critical splice donor site probably null
R0539:Ptprs UTSW 17 56458255 missense probably damaging 0.97
R0620:Ptprs UTSW 17 56429103 missense possibly damaging 0.93
R0683:Ptprs UTSW 17 56414086 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1474:Ptprs UTSW 17 56424128 missense probably damaging 0.98
R1502:Ptprs UTSW 17 56437992 missense probably benign 0.00
R1817:Ptprs UTSW 17 56419527 missense probably damaging 1.00
R1844:Ptprs UTSW 17 56434510 missense probably damaging 1.00
R2077:Ptprs UTSW 17 56434990 missense probably null 0.26
R2086:Ptprs UTSW 17 56454984 missense probably null 0.02
R2149:Ptprs UTSW 17 56417706 missense probably damaging 1.00
R3618:Ptprs UTSW 17 56428965 missense probably benign 0.25
R3722:Ptprs UTSW 17 56417485 missense probably damaging 1.00
R3771:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3772:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3773:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R4032:Ptprs UTSW 17 56413386 missense probably damaging 1.00
R4326:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4327:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4480:Ptprs UTSW 17 56426404 missense possibly damaging 0.79
R4505:Ptprs UTSW 17 56451678 missense possibly damaging 0.57
R4507:Ptprs UTSW 17 56419014 missense probably damaging 1.00
R4588:Ptprs UTSW 17 56425534 missense probably damaging 1.00
R4662:Ptprs UTSW 17 56417666 missense probably damaging 1.00
R4708:Ptprs UTSW 17 56428067 missense probably damaging 1.00
R5016:Ptprs UTSW 17 56419070 missense probably damaging 1.00
R5416:Ptprs UTSW 17 56435724 missense probably damaging 1.00
R5447:Ptprs UTSW 17 56429128 missense possibly damaging 0.50
R6041:Ptprs UTSW 17 56419080 missense probably benign 0.00
R6329:Ptprs UTSW 17 56417427 nonsense probably null
R6377:Ptprs UTSW 17 56418935 missense probably damaging 1.00
R6605:Ptprs UTSW 17 56422195 missense probably damaging 1.00
R6749:Ptprs UTSW 17 56437884 missense probably damaging 1.00
R7113:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7114:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7133:Ptprs UTSW 17 56417429 missense probably damaging 1.00
R7220:Ptprs UTSW 17 56418988 missense probably benign 0.29
R7423:Ptprs UTSW 17 56414793 missense probably damaging 1.00
R7440:Ptprs UTSW 17 56424256 missense possibly damaging 0.75
R7457:Ptprs UTSW 17 56419502 missense probably damaging 0.99
R7574:Ptprs UTSW 17 56423538 missense probably benign 0.00
R7851:Ptprs UTSW 17 56425482 missense probably benign
R7903:Ptprs UTSW 17 56424960 nonsense probably null
R7934:Ptprs UTSW 17 56425482 missense probably benign
R7986:Ptprs UTSW 17 56424960 nonsense probably null
X0028:Ptprs UTSW 17 56437831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTAGCTTACTCAAAACCTAATC -3'
(R):5'- GATTTTGTTGCACTGGCCCC -3'

Sequencing Primer
(F):5'- TGGGGTCTATCCACAGGAC -3'
(R):5'- GCCCCAGCCTCTTTGCC -3'
Posted On2019-12-04