Incidental Mutation 'RF014:Rnf14'
ID603447
Institutional Source Beutler Lab
Gene Symbol Rnf14
Ensembl Gene ENSMUSG00000060450
Gene Namering finger protein 14
Synonyms2310075C09Rik, Triad2, 2610005D23Rik, D18Ertd188e, D7Bwg0165e
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #RF014 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location38296635-38317847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38309570 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 308 (V308E)
Ref Sequence ENSEMBL: ENSMUSP00000072212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072376] [ENSMUST00000170811] [ENSMUST00000171461]
Predicted Effect probably damaging
Transcript: ENSMUST00000072376
AA Change: V308E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072212
Gene: ENSMUSG00000060450
AA Change: V308E

DomainStartEndE-ValueType
RWD 11 137 2.36e-32 SMART
low complexity region 169 179 N/A INTRINSIC
RING 221 266 6.51e-2 SMART
IBR 290 351 3.15e-18 SMART
IBR 387 454 2.11e-1 SMART
low complexity region 470 485 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170811
AA Change: V182E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133070
Gene: ENSMUSG00000060450
AA Change: V182E

DomainStartEndE-ValueType
low complexity region 43 53 N/A INTRINSIC
RING 95 140 6.51e-2 SMART
IBR 164 225 3.15e-18 SMART
IBR 261 328 2.11e-1 SMART
low complexity region 344 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171461
AA Change: V308E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126205
Gene: ENSMUSG00000060450
AA Change: V308E

DomainStartEndE-ValueType
RWD 11 137 2.36e-32 SMART
low complexity region 169 179 N/A INTRINSIC
RING 221 266 6.51e-2 SMART
IBR 290 351 3.15e-18 SMART
IBR 387 454 2.11e-1 SMART
low complexity region 470 485 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein interacts with androgen receptor (AR) and may function as a coactivator that induces AR target gene expression in prostate. A dominant negative mutant of this gene has been demonstrated to inhibit the AR-mediated growth of prostate cancer. This protein also interacts with class III ubiquitin-conjugating enzymes (E2s) and may act as a ubiquitin-ligase (E3) in the ubiquitination of certain nuclear proteins. Six alternatively spliced transcript variants encoding two distinct isoforms have been reported. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,857 probably benign Het
9530003J23Rik A G 10: 117,234,417 *152Q probably null Het
A2ml1 T C 6: 128,570,068 N366S probably damaging Het
Abca5 T C 11: 110,279,754 probably null Het
Acaca T C 11: 84,231,724 V323A probably benign Het
Agbl3 T A 6: 34,799,358 D266E possibly damaging Het
Aggf1 A T 13: 95,370,768 S170T possibly damaging Het
Amhr2 A T 15: 102,453,154 S467C probably benign Het
Begain GCCGCC GCCGCCACCGCC 12: 109,033,422 probably benign Het
Best3 A T 10: 117,004,505 Q280L probably damaging Het
Calhm1 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG 19: 47,141,265 probably benign Het
Ccdc186 A G 19: 56,813,472 L71S probably benign Het
Ces1d C A 8: 93,176,165 probably null Het
Chga AGC AGCGGC 12: 102,561,393 probably benign Het
Chga AGC AGCTGC 12: 102,561,405 probably benign Het
Clstn3 T A 6: 124,459,266 K212* probably null Het
Col16a1 TTTTT TTTTTCTTTT 4: 130,093,067 probably benign Het
Cpxm2 G T 7: 132,070,863 T319K possibly damaging Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACCGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dst T C 1: 34,247,679 S3364P probably benign Het
Edc4 C T 8: 105,884,600 T61M probably benign Het
Fndc5 A G 4: 129,142,167 H199R probably benign Het
Gm43302 T A 5: 105,274,757 I470F possibly damaging Het
Gne G T 4: 44,060,045 A147D probably damaging Het
Igkv12-89 G GCAACGCCAC 6: 68,835,286 probably benign Het
Irf9 C T 14: 55,605,877 R179* probably null Het
Jakmip1 A T 5: 37,174,526 K850M possibly damaging Het
Kalrn G A 16: 34,039,933 T1884I probably benign Het
Krtap28-10 CCACCACAGCCACAGCCACCACAGCCACAG CCACCACAGCCACAGACACCACAGCCACAGCCACCACAGCCACAG 1: 83,042,251 probably benign Het
Las1l CTCCTCCTTCTCCTCTTCCTC CTCCTC X: 95,940,657 probably benign Het
Lctl A G 9: 64,118,930 Y89C probably damaging Het
Lpgat1 GCC GCCTCC 1: 191,718,553 probably benign Het
Luzp2 A T 7: 55,172,205 I157F probably damaging Het
Mamld1 GCA GCACCA X: 71,118,845 probably benign Het
Map1a GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,295 probably benign Het
Mbd3l1 A T 9: 18,485,000 E140D possibly damaging Het
Mlh3 T A 12: 85,268,029 Q461L probably benign Het
Mto1 G T 9: 78,448,316 R7L probably benign Het
Muc4 A T 16: 32,751,858 S579C probably damaging Het
Ngfr T C 11: 95,578,201 Y117C probably damaging Het
Olfr432 A T 1: 174,050,987 I205F possibly damaging Het
Olfr537-ps1 A T 7: 140,538,777 M87L probably benign Het
Olfr926 C A 9: 38,877,900 H241Q probably benign Het
Plch2 A G 4: 155,007,120 S179P probably damaging Het
Pogz T G 3: 94,878,247 S838A possibly damaging Het
Pot1b T A 17: 55,674,106 T303S probably benign Het
Pou2f2 T A 7: 25,115,737 I72L unknown Het
Ppil2 C T 16: 17,097,418 V109M probably damaging Het
Ptpn4 A G 1: 119,684,465 probably null Het
Ptprs A T 17: 56,416,935 I1686N probably damaging Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,346 probably benign Het
Sgo2b T C 8: 63,931,405 T186A possibly damaging Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Stox1 T A 10: 62,664,246 H845L probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,665 probably benign Het
Thegl CAGCGATCCTCCCCAGTCCCGCA CAGCGATCCTCCCCAGTCCCGCAGGGCGAGCGATCCTCCCCAGTCCCGCA 5: 77,016,400 probably benign Het
Trappc9 A AGCTGCTGCTGCTGCT 15: 72,801,283 probably benign Het
Trim33 T C 3: 103,329,092 V506A possibly damaging Het
Uckl1 T C 2: 181,570,194 D373G probably benign Het
Vmn2r94 G T 17: 18,253,287 C492* probably null Het
Wdr33 A G 18: 31,881,273 D396G probably damaging Het
Zbtb11 A T 16: 55,980,597 I105L probably damaging Het
Zbtb40 A T 4: 137,017,306 C268S probably benign Het
Zfp36l1 T A 12: 80,109,744 M288L probably benign Het
Zfp384 CC CCAAGGCCCAGGAC 6: 125,036,466 probably benign Het
Zfp72 A G 13: 74,375,054 F15S probably benign Het
Znrd1as CACCACCACCAC CACCACCACCACCACCACCACGACCACCACCAC 17: 36,965,060 probably benign Het
Other mutations in Rnf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
aloft UTSW 18 38308382 missense probably damaging 1.00
souffle UTSW 18 38309576 missense probably damaging 1.00
R1682:Rnf14 UTSW 18 38308189 missense probably benign 0.00
R2299:Rnf14 UTSW 18 38308085 missense probably benign 0.03
R4246:Rnf14 UTSW 18 38301648 splice site probably null
R4941:Rnf14 UTSW 18 38308382 missense probably damaging 1.00
R5056:Rnf14 UTSW 18 38308388 missense probably damaging 1.00
R6082:Rnf14 UTSW 18 38301670 missense possibly damaging 0.69
R7070:Rnf14 UTSW 18 38301728 missense possibly damaging 0.66
R7772:Rnf14 UTSW 18 38309576 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTATTGCAAAACCCGCTTTG -3'
(R):5'- TGAGAGTTGGGTTCAGTTACAAC -3'

Sequencing Primer
(F):5'- AAAACCCGCTTTGCTTCTGGAATG -3'
(R):5'- GGGTTCAGTTACAACATACCTGCAG -3'
Posted On2019-12-04