Incidental Mutation 'RF015:Arid1a'
Institutional Source Beutler Lab
Gene Symbol Arid1a
Ensembl Gene ENSMUSG00000007880
Gene NameAT rich interactive domain 1A (SWI-like)
Synonyms1110030E03Rik, Smarcf1, BAF250a, Osa1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF015 (G1)
Quality Score107.67
Status Not validated
Chromosomal Location133679008-133756769 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGGC to A at 133752831 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008024] [ENSMUST00000105897] [ENSMUST00000145664]
Predicted Effect probably benign
Transcript: ENSMUST00000008024
SMART Domains Protein: ENSMUSP00000008024
Gene: ENSMUSG00000007880

low complexity region 17 42 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
low complexity region 113 211 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 274 290 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
internal_repeat_3 329 402 4.13e-5 PROSPERO
low complexity region 410 426 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
internal_repeat_1 443 563 4.59e-6 PROSPERO
internal_repeat_2 461 595 1.38e-5 PROSPERO
low complexity region 604 626 N/A INTRINSIC
ARID 630 720 3.56e-25 SMART
BRIGHT 634 725 3.76e-31 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
internal_repeat_3 778 872 4.13e-5 PROSPERO
internal_repeat_2 781 928 1.38e-5 PROSPERO
internal_repeat_1 825 940 4.59e-6 PROSPERO
low complexity region 962 987 N/A INTRINSIC
low complexity region 1014 1045 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1380 1404 N/A INTRINSIC
low complexity region 1500 1518 N/A INTRINSIC
Pfam:DUF3518 1592 1848 1.8e-146 PFAM
low complexity region 1849 1859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105897
SMART Domains Protein: ENSMUSP00000101517
Gene: ENSMUSG00000007880

low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_2 828 948 9.26e-7 PROSPERO
internal_repeat_1 831 980 9.26e-7 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_1 1159 1314 9.26e-7 PROSPERO
internal_repeat_2 1211 1326 9.26e-7 PROSPERO
low complexity region 1343 1368 N/A INTRINSIC
low complexity region 1395 1426 N/A INTRINSIC
low complexity region 1568 1581 N/A INTRINSIC
low complexity region 1761 1785 N/A INTRINSIC
low complexity region 1881 1899 N/A INTRINSIC
Pfam:DUF3518 1973 2229 1.4e-146 PFAM
low complexity region 2230 2240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145664
SMART Domains Protein: ENSMUSP00000122354
Gene: ENSMUSG00000007880

low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
internal_repeat_3 714 787 9.49e-6 PROSPERO
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_1 828 948 8.73e-7 PROSPERO
internal_repeat_2 846 980 2.88e-6 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_3 1163 1257 9.49e-6 PROSPERO
internal_repeat_2 1166 1313 2.88e-6 PROSPERO
internal_repeat_1 1210 1325 8.73e-7 PROSPERO
low complexity region 1347 1372 N/A INTRINSIC
low complexity region 1399 1430 N/A INTRINSIC
low complexity region 1572 1585 N/A INTRINSIC
low complexity region 1765 1789 N/A INTRINSIC
low complexity region 1885 1903 N/A INTRINSIC
Pfam:DUF3518 1978 2233 1.3e-117 PFAM
low complexity region 2234 2244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos with homozygous null alleles arrest development at E6.5 with failure to form a mesoderm layer. Mice homozygous for an allele lacking exon 2 and 3 die shortly after birth and exhibit an increase in the hematopoietic stem cell population of the fetal liver at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Arid1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Arid1a APN 4 133685482 missense unknown
IGL01139:Arid1a APN 4 133693997 missense unknown
IGL01392:Arid1a APN 4 133681037 missense unknown
IGL01543:Arid1a APN 4 133681722 missense unknown
IGL01642:Arid1a APN 4 133681844 missense unknown
IGL01843:Arid1a APN 4 133681454 missense unknown
IGL02108:Arid1a APN 4 133680516 missense unknown
IGL02117:Arid1a APN 4 133692815 missense unknown
IGL02150:Arid1a APN 4 133687257 missense unknown
IGL02478:Arid1a APN 4 133681274 missense unknown
IGL02544:Arid1a APN 4 133681748 missense unknown
IGL03070:Arid1a APN 4 133694753 missense unknown
PIT4520001:Arid1a UTSW 4 133681916 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0419:Arid1a UTSW 4 133681124 missense unknown
R0452:Arid1a UTSW 4 133689105 missense unknown
R0631:Arid1a UTSW 4 133689170 missense unknown
R0648:Arid1a UTSW 4 133685204 missense unknown
R1004:Arid1a UTSW 4 133687275 missense unknown
R1225:Arid1a UTSW 4 133687365 missense unknown
R1229:Arid1a UTSW 4 133691237 missense unknown
R1435:Arid1a UTSW 4 133680698 missense unknown
R1480:Arid1a UTSW 4 133680389 missense unknown
R1491:Arid1a UTSW 4 133720926 missense unknown
R1674:Arid1a UTSW 4 133689260 missense unknown
R1909:Arid1a UTSW 4 133693761 missense unknown
R1960:Arid1a UTSW 4 133753090 missense possibly damaging 0.84
R2018:Arid1a UTSW 4 133681834 missense unknown
R2147:Arid1a UTSW 4 133681366 missense unknown
R2303:Arid1a UTSW 4 133687251 missense unknown
R2320:Arid1a UTSW 4 133680529 missense unknown
R3775:Arid1a UTSW 4 133686764 missense unknown
R3907:Arid1a UTSW 4 133692912 splice site probably benign
R4509:Arid1a UTSW 4 133695699 intron probably benign
R4510:Arid1a UTSW 4 133695699 intron probably benign
R4551:Arid1a UTSW 4 133695699 intron probably benign
R4552:Arid1a UTSW 4 133695699 intron probably benign
R4606:Arid1a UTSW 4 133687323 missense unknown
R4745:Arid1a UTSW 4 133753106 missense probably benign 0.33
R4851:Arid1a UTSW 4 133681361 missense unknown
R4867:Arid1a UTSW 4 133720857 missense probably benign 0.01
R5203:Arid1a UTSW 4 133682003 missense unknown
R5227:Arid1a UTSW 4 133680405 missense unknown
R5294:Arid1a UTSW 4 133691055 splice site probably benign
R5299:Arid1a UTSW 4 133687226 missense unknown
R5412:Arid1a UTSW 4 133719602 unclassified probably benign
R5540:Arid1a UTSW 4 133680454 missense unknown
R5704:Arid1a UTSW 4 133681739 missense unknown
R5870:Arid1a UTSW 4 133681076 missense unknown
R6092:Arid1a UTSW 4 133693852 missense unknown
R6151:Arid1a UTSW 4 133684976 missense unknown
R6240:Arid1a UTSW 4 133680686 missense unknown
R6379:Arid1a UTSW 4 133680927 missense unknown
R6427:Arid1a UTSW 4 133681524 missense unknown
R6739:Arid1a UTSW 4 133687626 missense unknown
R7159:Arid1a UTSW 4 133753568 missense unknown
R7186:Arid1a UTSW 4 133753233
R7354:Arid1a UTSW 4 133693947 missense unknown
R7408:Arid1a UTSW 4 133681080 missense unknown
R7452:Arid1a UTSW 4 133753127 missense possibly damaging 0.86
R7471:Arid1a UTSW 4 133681044 missense unknown
R7478:Arid1a UTSW 4 133685171 missense unknown
R7581:Arid1a UTSW 4 133680351 missense unknown
R7614:Arid1a UTSW 4 133691155 missense unknown
R7712:Arid1a UTSW 4 133752611 missense probably benign 0.14
R7734:Arid1a UTSW 4 133681368 missense unknown
R7878:Arid1a UTSW 4 133687271 missense unknown
R7961:Arid1a UTSW 4 133687271 missense unknown
R8012:Arid1a UTSW 4 133692863 missense unknown
RF012:Arid1a UTSW 4 133752820 small deletion probably benign
X0064:Arid1a UTSW 4 133689260 missense unknown
Z1176:Arid1a UTSW 4 133720550 missense probably null
Z1177:Arid1a UTSW 4 133680916 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04