Incidental Mutation 'RF015:Gm7534'
Institutional Source Beutler Lab
Gene Symbol Gm7534
Ensembl Gene ENSMUSG00000073747
Gene Namepredicted gene 7534
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #RF015 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location134190804-134203004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134193027 bp
Amino Acid Change Histidine to Arginine at position 609 (H609R)
Ref Sequence ENSEMBL: ENSMUSP00000095461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097849]
Predicted Effect probably benign
Transcript: ENSMUST00000097849
AA Change: H609R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095461
Gene: ENSMUSG00000073747
AA Change: H609R

low complexity region 1 16 N/A INTRINSIC
internal_repeat_1 21 111 5.47e-40 PROSPERO
low complexity region 112 143 N/A INTRINSIC
low complexity region 158 177 N/A INTRINSIC
internal_repeat_1 181 271 5.47e-40 PROSPERO
low complexity region 322 334 N/A INTRINSIC
ZP 368 618 3.21e-13 SMART
low complexity region 650 668 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Gm7534
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Gm7534 APN 4 134201980 missense probably benign 0.27
IGL03170:Gm7534 APN 4 134193034 missense possibly damaging 0.57
FR4342:Gm7534 UTSW 4 134202631 small insertion probably benign
FR4976:Gm7534 UTSW 4 134202630 small insertion probably benign
R0487:Gm7534 UTSW 4 134202778 missense probably damaging 0.97
R0530:Gm7534 UTSW 4 134202910 missense probably benign
R0553:Gm7534 UTSW 4 134202518 missense possibly damaging 0.85
R1121:Gm7534 UTSW 4 134202937 missense probably benign 0.00
R1458:Gm7534 UTSW 4 134196833 missense probably benign 0.01
R1748:Gm7534 UTSW 4 134200299 missense probably damaging 1.00
R1748:Gm7534 UTSW 4 134202119 missense possibly damaging 0.57
R1913:Gm7534 UTSW 4 134192675 critical splice donor site probably null
R2029:Gm7534 UTSW 4 134202358 missense possibly damaging 0.87
R2069:Gm7534 UTSW 4 134201941 missense possibly damaging 0.63
R2237:Gm7534 UTSW 4 134202205 missense unknown
R2239:Gm7534 UTSW 4 134202205 missense unknown
R3943:Gm7534 UTSW 4 134200345 missense probably benign 0.15
R4646:Gm7534 UTSW 4 134202148 missense probably benign 0.00
R4673:Gm7534 UTSW 4 134200347 missense probably benign 0.01
R4838:Gm7534 UTSW 4 134193099 missense probably benign 0.04
R5002:Gm7534 UTSW 4 134196920 missense probably benign 0.09
R5593:Gm7534 UTSW 4 134193039 missense probably damaging 0.99
R5606:Gm7534 UTSW 4 134200212 missense probably benign 0.13
R6553:Gm7534 UTSW 4 134202056 missense probably damaging 0.99
R6834:Gm7534 UTSW 4 134193165 missense possibly damaging 0.95
R6931:Gm7534 UTSW 4 134193153 missense probably benign 0.28
R7526:Gm7534 UTSW 4 134200073 splice site probably null
R7771:Gm7534 UTSW 4 134195443 missense probably benign 0.01
R8271:Gm7534 UTSW 4 134202967 missense unknown
R8725:Gm7534 UTSW 4 134202839 missense probably benign 0.19
R8727:Gm7534 UTSW 4 134202839 missense probably benign 0.19
R8757:Gm7534 UTSW 4 134202971 missense unknown
T0975:Gm7534 UTSW 4 134202629 small insertion probably benign
Z1176:Gm7534 UTSW 4 134200338 missense possibly damaging 0.90
Z1176:Gm7534 UTSW 4 134202677 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04