Incidental Mutation 'RF015:Efhd2'
ID603462
Institutional Source Beutler Lab
Gene Symbol Efhd2
Ensembl Gene ENSMUSG00000040659
Gene NameEF hand domain containing 2
Synonymsswiprosin 1, D4Wsu27e, 2600015J22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #RF015 (G1)
Quality Score217.468
Status Not validated
Chromosome4
Chromosomal Location141858142-141874920 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) CCGCCG to CCGCCGACGCCG at 141874756 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036854]
Predicted Effect probably benign
Transcript: ENSMUST00000036854
SMART Domains Protein: ENSMUSP00000044502
Gene: ENSMUSG00000040659

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
EFh 96 124 1.44e-2 SMART
EFh 132 160 2.71e0 SMART
coiled coil region 199 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced germinal center responses and humoral type 2 immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
5430401F13Rik CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,856 probably benign Het
5430401F13Rik AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,859 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,861 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Cyb5r4 CTGCCCAGGGA CTGCCCAGGGATGTGACAGACACATTGCCCAGGGA 9: 87,040,438 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Dnmt1 GGAGCACAGTTCCTACCTCGTT GGAGCACAGTTCCTACCTCGTTTTGGGGGCTGAGCACAGTTCCTACCTCGTT 9: 20,910,124 probably null Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGGGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Slc26a8 TCTCTGGCTCTGGCTCTGGCTCTGGCTC TCTCTGGCTCTGGCTCTGGCTC 17: 28,638,341 probably benign Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Usp2 TGTGACCTGTTCTTCACTTAC TGTGACCTGTTCTTCACTTACTCACGTGACCTGTTCTTCACTTAC 9: 44,089,109 probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Efhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Efhd2 APN 4 141859865 missense probably benign 0.05
IGL01710:Efhd2 APN 4 141860561 missense probably damaging 1.00
IGL01869:Efhd2 APN 4 141874602 missense probably damaging 1.00
FR4589:Efhd2 UTSW 4 141874764 small insertion probably benign
R0109:Efhd2 UTSW 4 141874567 missense probably benign 0.00
R0711:Efhd2 UTSW 4 141859872 missense probably damaging 1.00
R6861:Efhd2 UTSW 4 141859881 splice site probably null
R7765:Efhd2 UTSW 4 141874575 missense probably damaging 0.97
R8275:Efhd2 UTSW 4 141874762 missense probably benign 0.31
R8504:Efhd2 UTSW 4 141859875 nonsense probably null
RF008:Efhd2 UTSW 4 141874758 small insertion probably benign
RF010:Efhd2 UTSW 4 141874764 small insertion probably benign
RF012:Efhd2 UTSW 4 141874768 small insertion probably benign
RF016:Efhd2 UTSW 4 141874756 small insertion probably benign
RF021:Efhd2 UTSW 4 141874773 small insertion probably benign
RF023:Efhd2 UTSW 4 141874762 small insertion probably benign
RF024:Efhd2 UTSW 4 141874762 small insertion probably benign
RF025:Efhd2 UTSW 4 141874771 small insertion probably benign
RF032:Efhd2 UTSW 4 141874772 small insertion probably benign
RF044:Efhd2 UTSW 4 141874768 small insertion probably benign
RF056:Efhd2 UTSW 4 141874767 small insertion probably benign
RF057:Efhd2 UTSW 4 141874769 small insertion probably benign
RF062:Efhd2 UTSW 4 141874755 small insertion probably benign
RF062:Efhd2 UTSW 4 141874774 small insertion probably benign
RF064:Efhd2 UTSW 4 141874755 small insertion probably benign
Z1177:Efhd2 UTSW 4 141874683 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTGCTTCCTGGAGAACTCC -3'
(R):5'- TCACCCAGAGGTCATCAGAG -3'

Sequencing Primer
(F):5'- AGAACTCCTTGAACTCGGTG -3'
(R):5'- TAAGTCCCACCTTCAGGGC -3'
Posted On2019-12-04