Incidental Mutation 'RF015:Wdr66'
ID603466
Institutional Source Beutler Lab
Gene Symbol Wdr66
Ensembl Gene ENSMUSG00000029442
Gene NameWD repeat domain 66
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #RF015 (G1)
Quality Score188.536
Status Not validated
Chromosome5
Chromosomal Location123252102-123327484 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GGAGGAGGAGGAG to GGAGGAGGAGGAGGAG at 123254242 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100729] [ENSMUST00000121964]
Predicted Effect probably benign
Transcript: ENSMUST00000100729
SMART Domains Protein: ENSMUSP00000098295
Gene: ENSMUSG00000029440

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Blast:PDZ 20 58 7e-7 BLAST
PDB:3WHL|H 23 99 2e-12 PDB
PDZ 121 195 5.02e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121964
SMART Domains Protein: ENSMUSP00000113309
Gene: ENSMUSG00000029442

DomainStartEndE-ValueType
coiled coil region 9 160 N/A INTRINSIC
coiled coil region 243 299 N/A INTRINSIC
WD40 437 478 1.58e-2 SMART
WD40 481 525 6.16e0 SMART
Blast:WD40 532 572 2e-15 BLAST
Blast:WD40 584 623 5e-17 BLAST
low complexity region 627 641 N/A INTRINSIC
WD40 643 677 7.64e1 SMART
Blast:WD40 686 742 1e-13 BLAST
WD40 745 784 8.62e-4 SMART
WD40 789 827 1.19e1 SMART
WD40 832 871 5.97e-1 SMART
WD40 880 923 1.23e2 SMART
WD40 1030 1070 1.15e0 SMART
low complexity region 1274 1285 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member appears to function in the determination of mean platelet volume (MPV), and polymorphisms in this gene have been associated with variance in MPV. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
5430401F13Rik CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,856 probably benign Het
5430401F13Rik AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,859 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,861 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Cyb5r4 CTGCCCAGGGA CTGCCCAGGGATGTGACAGACACATTGCCCAGGGA 9: 87,040,438 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Dnmt1 GGAGCACAGTTCCTACCTCGTT GGAGCACAGTTCCTACCTCGTTTTGGGGGCTGAGCACAGTTCCTACCTCGTT 9: 20,910,124 probably null Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGGGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Slc26a8 TCTCTGGCTCTGGCTCTGGCTCTGGCTC TCTCTGGCTCTGGCTCTGGCTC 17: 28,638,341 probably benign Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Usp2 TGTGACCTGTTCTTCACTTAC TGTGACCTGTTCTTCACTTACTCACGTGACCTGTTCTTCACTTAC 9: 44,089,109 probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Wdr66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Wdr66 APN 5 123274177 missense probably damaging 1.00
IGL01090:Wdr66 APN 5 123279989 splice site probably benign
IGL01387:Wdr66 APN 5 123283546 missense probably damaging 1.00
IGL01432:Wdr66 APN 5 123279952 missense possibly damaging 0.88
IGL01642:Wdr66 APN 5 123288698 missense possibly damaging 0.77
IGL01720:Wdr66 APN 5 123322494 missense probably benign 0.07
IGL02104:Wdr66 APN 5 123302698 nonsense probably null
IGL02160:Wdr66 APN 5 123256018 missense unknown
IGL02238:Wdr66 APN 5 123302423 missense probably damaging 1.00
IGL02820:Wdr66 APN 5 123254636 unclassified probably benign
IGL03183:Wdr66 APN 5 123254619 unclassified probably benign
R0078:Wdr66 UTSW 5 123298570 missense probably benign 0.04
R0207:Wdr66 UTSW 5 123283447 missense probably damaging 0.98
R0411:Wdr66 UTSW 5 123290054 missense probably damaging 1.00
R0414:Wdr66 UTSW 5 123287413 splice site probably null
R0722:Wdr66 UTSW 5 123256185 missense probably damaging 1.00
R1169:Wdr66 UTSW 5 123254610 small deletion probably benign
R1527:Wdr66 UTSW 5 123287345 missense probably benign 0.19
R1924:Wdr66 UTSW 5 123302739 missense possibly damaging 0.67
R2022:Wdr66 UTSW 5 123273790 missense probably benign 0.29
R2110:Wdr66 UTSW 5 123254375 unclassified probably benign
R2112:Wdr66 UTSW 5 123254375 unclassified probably benign
R2147:Wdr66 UTSW 5 123256191 missense probably benign 0.01
R2258:Wdr66 UTSW 5 123283348 splice site probably null
R2407:Wdr66 UTSW 5 123289969 missense probably benign 0.11
R2418:Wdr66 UTSW 5 123254268 unclassified probably benign
R2497:Wdr66 UTSW 5 123283369 missense probably damaging 1.00
R2509:Wdr66 UTSW 5 123256106 missense probably benign 0.00
R3437:Wdr66 UTSW 5 123254372 unclassified probably benign
R3730:Wdr66 UTSW 5 123326568 missense possibly damaging 0.70
R3800:Wdr66 UTSW 5 123254721 unclassified probably benign
R4018:Wdr66 UTSW 5 123322454 missense probably benign 0.04
R4181:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4302:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4640:Wdr66 UTSW 5 123302432 missense probably benign 0.00
R4701:Wdr66 UTSW 5 123322613 missense probably benign 0.00
R4799:Wdr66 UTSW 5 123302772 missense probably benign 0.04
R4812:Wdr66 UTSW 5 123287305 missense probably benign 0.01
R4922:Wdr66 UTSW 5 123256053 missense probably benign 0.00
R5123:Wdr66 UTSW 5 123273633 start gained probably benign
R5314:Wdr66 UTSW 5 123322563 missense probably benign 0.01
R5445:Wdr66 UTSW 5 123287177 missense probably damaging 1.00
R5458:Wdr66 UTSW 5 123254445 unclassified probably benign
R5462:Wdr66 UTSW 5 123298632 critical splice donor site probably null
R5514:Wdr66 UTSW 5 123287766 critical splice donor site probably null
R5600:Wdr66 UTSW 5 123288698 missense possibly damaging 0.77
R5635:Wdr66 UTSW 5 123322572 missense probably benign 0.25
R5767:Wdr66 UTSW 5 123298521 missense probably benign 0.01
R5943:Wdr66 UTSW 5 123286357 missense probably benign 0.13
R6000:Wdr66 UTSW 5 123254372 unclassified probably benign
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6293:Wdr66 UTSW 5 123322448 missense probably damaging 1.00
R6354:Wdr66 UTSW 5 123302755 missense probably damaging 0.99
R6356:Wdr66 UTSW 5 123254666 unclassified probably benign
R6427:Wdr66 UTSW 5 123326533 missense probably damaging 1.00
R6896:Wdr66 UTSW 5 123278358 missense possibly damaging 0.81
R6909:Wdr66 UTSW 5 123287752 missense probably damaging 1.00
R7503:Wdr66 UTSW 5 123297458 nonsense probably null
R7707:Wdr66 UTSW 5 123253887 missense probably benign 0.00
R7715:Wdr66 UTSW 5 123262134 missense probably damaging 1.00
R7809:Wdr66 UTSW 5 123264831 missense probably damaging 1.00
R7819:Wdr66 UTSW 5 123254259 unclassified probably benign
R7842:Wdr66 UTSW 5 123254424 missense unknown
R7898:Wdr66 UTSW 5 123322454 missense probably damaging 0.99
R7967:Wdr66 UTSW 5 123283516 missense possibly damaging 0.89
R8004:Wdr66 UTSW 5 123254450 missense unknown
R8068:Wdr66 UTSW 5 123256166 missense not run
R8141:Wdr66 UTSW 5 123286430 missense possibly damaging 0.83
R8222:Wdr66 UTSW 5 123302423 missense probably damaging 1.00
R8242:Wdr66 UTSW 5 123273851 missense possibly damaging 0.89
R8303:Wdr66 UTSW 5 123322587 missense probably damaging 0.99
R8323:Wdr66 UTSW 5 123297525 missense probably benign 0.16
R8773:Wdr66 UTSW 5 123273850 missense probably benign 0.12
RF007:Wdr66 UTSW 5 123254254 small insertion probably benign
RF010:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF015:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF017:Wdr66 UTSW 5 123253890 small insertion probably benign
RF024:Wdr66 UTSW 5 123253883 small insertion probably benign
RF024:Wdr66 UTSW 5 123253888 small insertion probably benign
RF024:Wdr66 UTSW 5 123253889 small insertion probably benign
X0062:Wdr66 UTSW 5 123274237 missense probably benign 0.29
X0066:Wdr66 UTSW 5 123288647 missense probably benign 0.05
Predicted Primers
Posted On2019-12-04