Incidental Mutation 'RF015:Pik3c2g'
ID 603474
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # RF015 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 139591070-139915010 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139700497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 262 (N262K)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111868] [ENSMUST00000218528]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: N262K

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,824 (GRCm39) probably benign Het
5430401F13Rik AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,822 (GRCm39) probably benign Het
5430401F13Rik CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,819 (GRCm39) probably benign Het
Abcb4 GAA G 5: 8,946,594 (GRCm39) probably null Het
Agap1 T A 1: 89,561,985 (GRCm39) Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 122,886,085 (GRCm39) probably benign Het
Arid1a AGGC A 4: 133,480,142 (GRCm39) probably benign Het
Bco2 A G 9: 50,457,297 (GRCm39) F82L probably damaging Het
Bltp1 TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,104,897 (GRCm39) probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,129,695 (GRCm39) probably benign Het
Capn9 T C 8: 125,345,221 (GRCm39) F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 119,963,794 (GRCm39) probably benign Het
Cfap251 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,392,305 (GRCm39) probably benign Het
Cfap251 TCTCA T 5: 123,412,224 (GRCm39) probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,631,997 (GRCm39) probably benign Het
Chga AGC AGCGGC 12: 102,527,679 (GRCm39) probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 86,922,485 (GRCm39) probably benign Het
Cyb5r4 CTGCCCAGGGA CTGCCCAGGGATGTGACAGACACATTGCCCAGGGA 9: 86,922,491 (GRCm39) probably benign Het
Cyria T A 12: 12,419,939 (GRCm39) S294R probably benign Het
Dnah10 G A 5: 124,895,141 (GRCm39) D3557N probably damaging Het
Dnmt1 GGAGCACAGTTCCTACCTCGTT GGAGCACAGTTCCTACCTCGTTTTGGGGGCTGAGCACAGTTCCTACCTCGTT 9: 20,821,420 (GRCm39) probably null Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGGGCGGAGCCCAGTTCCTACCTCGTT 9: 20,821,425 (GRCm39) probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,602,067 (GRCm39) probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,522,691 (GRCm39) probably benign Het
Garin5a TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,149,946 (GRCm39) probably null Het
Gatad1 A T 5: 3,697,523 (GRCm39) C33S possibly damaging Het
H2-DMb1 A G 17: 34,374,476 (GRCm39) Y42C probably damaging Het
Hars2 G T 18: 36,918,998 (GRCm39) R86L probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 (GRCm39) probably benign Het
Irag2 AGCACATTG AGCACATTGCGCACATTG 6: 145,119,509 (GRCm39) probably benign Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 92,925,455 (GRCm39) probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,532,752 (GRCm39) probably benign Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Mamld1 AGC AGCCGC X: 70,162,447 (GRCm39) probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,875,755 (GRCm39) probably null Het
Mucl2 T A 15: 103,927,696 (GRCm39) N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Nup214 T C 2: 31,924,718 (GRCm39) V1749A probably benign Het
Or52e5 A G 7: 104,719,255 (GRCm39) I194V probably damaging Het
Pcdhgb4 A T 18: 37,854,855 (GRCm39) N417Y probably damaging Het
Pclo G T 5: 14,565,283 (GRCm39) L16F unknown Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,102,467 (GRCm39) probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,694,353 (GRCm39) probably benign Het
Rnf41 C T 10: 128,271,279 (GRCm39) A63V probably benign Het
Sirt1 C T 10: 63,172,795 (GRCm39) A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,928,798 (GRCm39) probably benign Het
Six4 TG T 12: 73,150,356 (GRCm39) probably null Het
Skor2 A G 18: 76,948,483 (GRCm39) E735G probably damaging Het
Slc26a8 TCTCTGGCTCTGGCTCTGGCTCTGGCTC TCTCTGGCTCTGGCTCTGGCTC 17: 28,857,315 (GRCm39) probably benign Het
Smco2 T TTCG 6: 146,754,161 (GRCm39) probably benign Het
Strada A G 11: 106,061,846 (GRCm39) I172T probably damaging Het
Syne1 T C 10: 5,252,248 (GRCm39) I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,966,656 (GRCm39) probably benign Het
Tram1 T C 1: 13,649,966 (GRCm39) Y86C probably damaging Het
Ttll7 T A 3: 146,685,413 (GRCm39) F882L probably benign Het
Usp2 TGTGACCTGTTCTTCACTTAC TGTGACCTGTTCTTCACTTACTCACGTGACCTGTTCTTCACTTAC 9: 44,000,406 (GRCm39) probably benign Het
Utp18 A G 11: 93,776,287 (GRCm39) L66P probably damaging Het
Wnt7a C T 6: 91,371,405 (GRCm39) E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,013,444 (GRCm39) probably benign Het
Zgrf1 A G 3: 127,356,882 (GRCm39) I703V probably benign Het
Zpld2 T C 4: 133,920,338 (GRCm39) H609R probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139,841,851 (GRCm39) missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139,798,583 (GRCm39) missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01580:Pik3c2g APN 6 139,599,514 (GRCm39) missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01813:Pik3c2g APN 6 139,599,407 (GRCm39) missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139,806,081 (GRCm39) missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139,863,730 (GRCm39) missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139,798,526 (GRCm39) missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139,682,699 (GRCm39) missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139,913,554 (GRCm39) missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139,718,133 (GRCm39) critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4340:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4976:Pik3c2g UTSW 6 139,612,652 (GRCm39) frame shift probably null
IGL02837:Pik3c2g UTSW 6 139,603,562 (GRCm39) nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139,805,096 (GRCm39) missense
R0002:Pik3c2g UTSW 6 139,714,471 (GRCm39) missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139,903,519 (GRCm39) missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139,639,441 (GRCm39) missense unknown
R0719:Pik3c2g UTSW 6 139,606,723 (GRCm39) missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139,903,425 (GRCm39) splice site probably benign
R0840:Pik3c2g UTSW 6 139,841,798 (GRCm39) missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139,718,154 (GRCm39) missense probably benign
R1501:Pik3c2g UTSW 6 139,789,796 (GRCm39) critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139,693,904 (GRCm39) missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139,612,634 (GRCm39) intron probably benign
R1907:Pik3c2g UTSW 6 139,789,768 (GRCm39) missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139,846,112 (GRCm39) critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139,599,546 (GRCm39) missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139,801,012 (GRCm39) nonsense probably null
R2188:Pik3c2g UTSW 6 139,798,600 (GRCm39) missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139,801,018 (GRCm39) missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139,798,589 (GRCm39) missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139,612,608 (GRCm39) intron probably benign
R4108:Pik3c2g UTSW 6 139,676,096 (GRCm39) missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139,787,407 (GRCm39) intron probably benign
R4474:Pik3c2g UTSW 6 139,610,749 (GRCm39) missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139,665,732 (GRCm39) missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139,665,744 (GRCm39) missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139,714,505 (GRCm39) missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139,913,528 (GRCm39) missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139,841,928 (GRCm39) missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5072:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5073:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5074:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5107:Pik3c2g UTSW 6 139,612,623 (GRCm39) intron probably benign
R5186:Pik3c2g UTSW 6 139,599,016 (GRCm39) missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139,841,983 (GRCm39) critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139,599,121 (GRCm39) missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139,665,808 (GRCm39) missense probably benign
R5417:Pik3c2g UTSW 6 139,682,669 (GRCm39) missense probably benign
R5435:Pik3c2g UTSW 6 139,661,581 (GRCm39) splice site probably null
R5580:Pik3c2g UTSW 6 139,603,531 (GRCm39) missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139,682,733 (GRCm39) missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R5914:Pik3c2g UTSW 6 139,599,477 (GRCm39) missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139,842,518 (GRCm39) missense probably damaging 1.00
R6046:Pik3c2g UTSW 6 139,599,137 (GRCm39) missense probably damaging 0.96
R6298:Pik3c2g UTSW 6 139,603,561 (GRCm39) missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139,665,724 (GRCm39) missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139,676,195 (GRCm39) missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139,841,899 (GRCm39) missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139,903,502 (GRCm39) missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139,599,061 (GRCm39) missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139,606,868 (GRCm39) missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139,805,990 (GRCm39) missense
R7215:Pik3c2g UTSW 6 139,700,589 (GRCm39) missense
R7332:Pik3c2g UTSW 6 139,841,981 (GRCm39) missense
R7357:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139,913,620 (GRCm39) missense unknown
R7385:Pik3c2g UTSW 6 139,801,079 (GRCm39) missense
R7455:Pik3c2g UTSW 6 139,913,643 (GRCm39) missense unknown
R7651:Pik3c2g UTSW 6 139,599,070 (GRCm39) missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139,842,470 (GRCm39) missense
R7923:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139,827,786 (GRCm39) missense
R8005:Pik3c2g UTSW 6 139,599,067 (GRCm39) missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139,881,782 (GRCm39) missense unknown
R8724:Pik3c2g UTSW 6 139,913,619 (GRCm39) missense unknown
R8733:Pik3c2g UTSW 6 139,714,426 (GRCm39) nonsense probably null
R8809:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R8888:Pik3c2g UTSW 6 139,676,092 (GRCm39) nonsense probably null
R8931:Pik3c2g UTSW 6 139,821,093 (GRCm39) missense probably benign 0.02
R9188:Pik3c2g UTSW 6 139,599,401 (GRCm39) missense possibly damaging 0.94
R9336:Pik3c2g UTSW 6 139,821,161 (GRCm39) missense
R9383:Pik3c2g UTSW 6 139,827,742 (GRCm39) nonsense probably null
R9524:Pik3c2g UTSW 6 139,606,768 (GRCm39) missense probably damaging 0.99
R9531:Pik3c2g UTSW 6 139,841,926 (GRCm39) missense
R9630:Pik3c2g UTSW 6 139,599,237 (GRCm39) missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139,913,517 (GRCm39) missense unknown
R9708:Pik3c2g UTSW 6 139,606,865 (GRCm39) missense probably benign
R9717:Pik3c2g UTSW 6 139,841,910 (GRCm39) missense
RF032:Pik3c2g UTSW 6 139,612,656 (GRCm39) frame shift probably null
X0024:Pik3c2g UTSW 6 139,805,984 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAACCAGTTTTCCCGATAGAAAC -3'
(R):5'- CTGGGCGATTAACTCCACAG -3'

Sequencing Primer
(F):5'- GTTTTCCCGATAGAAACTGAAACAC -3'
(R):5'- GTGTTCCCCATCACATATCAAC -3'
Posted On 2019-12-04