Incidental Mutation 'RF015:Lrmp'
ID603475
Institutional Source Beutler Lab
Gene Symbol Lrmp
Ensembl Gene ENSMUSG00000030263
Gene Namelymphoid-restricted membrane protein
SynonymsD6Int8, D6Int7, D6Int5, D6Int4, D6Int3, Jaw1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF015 (G1)
Quality Score214.458
Status Not validated
Chromosome6
Chromosomal Location145115653-145174934 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) AGCACATTG to AGCACATTGCGCACATTG at 145173783 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
Predicted Effect probably benign
Transcript: ENSMUST00000032396
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060797
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111728
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132948
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect probably benign
Transcript: ENSMUST00000204105
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encode dby this gene is expressed in a developmentally regulated manner in lymphoid cell lines and tissues. The protein is localized to the cytoplasmic face of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
5430401F13Rik CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,856 probably benign Het
5430401F13Rik AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,859 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,861 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Cyb5r4 CTGCCCAGGGA CTGCCCAGGGATGTGACAGACACATTGCCCAGGGA 9: 87,040,438 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Dnmt1 GGAGCACAGTTCCTACCTCGTT GGAGCACAGTTCCTACCTCGTTTTGGGGGCTGAGCACAGTTCCTACCTCGTT 9: 20,910,124 probably null Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGGGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Slc26a8 TCTCTGGCTCTGGCTCTGGCTCTGGCTC TCTCTGGCTCTGGCTCTGGCTC 17: 28,638,341 probably benign Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Usp2 TGTGACCTGTTCTTCACTTAC TGTGACCTGTTCTTCACTTACTCACGTGACCTGTTCTTCACTTAC 9: 44,089,109 probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Lrmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Lrmp APN 6 145167994 missense probably damaging 1.00
IGL01066:Lrmp APN 6 145160955 missense probably damaging 1.00
IGL01877:Lrmp APN 6 145147799 missense probably damaging 0.99
IGL02154:Lrmp APN 6 145138241 missense possibly damaging 0.92
IGL02727:Lrmp APN 6 145174618 missense possibly damaging 0.78
FR4976:Lrmp UTSW 6 145173785 unclassified probably benign
R0238:Lrmp UTSW 6 145171978 unclassified probably benign
R0239:Lrmp UTSW 6 145171978 unclassified probably benign
R0454:Lrmp UTSW 6 145167984 missense possibly damaging 0.73
R0485:Lrmp UTSW 6 145165212 missense probably damaging 1.00
R0487:Lrmp UTSW 6 145165260 missense probably benign 0.02
R0554:Lrmp UTSW 6 145165287 missense probably benign 0.01
R0634:Lrmp UTSW 6 145174628 missense probably damaging 0.98
R1440:Lrmp UTSW 6 145174511 missense possibly damaging 0.77
R1574:Lrmp UTSW 6 145158630 splice site probably benign
R1697:Lrmp UTSW 6 145137615 splice site probably benign
R1968:Lrmp UTSW 6 145169773 missense probably damaging 0.98
R3735:Lrmp UTSW 6 145160870 splice site probably benign
R3736:Lrmp UTSW 6 145160870 splice site probably benign
R4643:Lrmp UTSW 6 145168060 missense probably benign 0.17
R4812:Lrmp UTSW 6 145148011 missense probably damaging 1.00
R4916:Lrmp UTSW 6 145165301 missense probably damaging 1.00
R5183:Lrmp UTSW 6 145138220 missense probably benign 0.23
R5845:Lrmp UTSW 6 145171666 missense probably benign 0.00
R6701:Lrmp UTSW 6 145144976 nonsense probably null
R6735:Lrmp UTSW 6 145160893 missense probably damaging 1.00
R7083:Lrmp UTSW 6 145169783 missense probably damaging 1.00
R7317:Lrmp UTSW 6 145158698 missense possibly damaging 0.93
R7468:Lrmp UTSW 6 145173701 splice site probably null
R8429:Lrmp UTSW 6 145165223 missense probably damaging 1.00
R8485:Lrmp UTSW 6 145171674 missense probably damaging 1.00
R8779:Lrmp UTSW 6 145138199 missense probably benign 0.00
RF003:Lrmp UTSW 6 145173783 unclassified probably benign
RF017:Lrmp UTSW 6 145173784 unclassified probably benign
RF027:Lrmp UTSW 6 145173790 unclassified probably benign
RF029:Lrmp UTSW 6 145173790 unclassified probably benign
RF030:Lrmp UTSW 6 145173788 unclassified probably benign
RF030:Lrmp UTSW 6 145173790 unclassified probably benign
RF038:Lrmp UTSW 6 145173790 unclassified probably benign
RF043:Lrmp UTSW 6 145173790 unclassified probably benign
RF044:Lrmp UTSW 6 145173790 unclassified probably benign
RF048:Lrmp UTSW 6 145173784 unclassified probably benign
RF052:Lrmp UTSW 6 145160531 critical splice acceptor site probably benign
RF054:Lrmp UTSW 6 145173788 unclassified probably benign
RF055:Lrmp UTSW 6 145173785 unclassified probably benign
Z1177:Lrmp UTSW 6 145148074 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTAAGACTGACTTCTGTAATTC -3'
(R):5'- AAAACTGTTAGGTGGGGCCC -3'

Sequencing Primer
(F):5'- AAGACTGACTTCTGTAATTCTTCCTG -3'
(R):5'- GGGCCCTTCTATAAAGCAGTCTG -3'
Posted On2019-12-04