Incidental Mutation 'RF015:Olfr678'
Institutional Source Beutler Lab
Gene Symbol Olfr678
Ensembl Gene ENSMUSG00000073913
Gene Nameolfactory receptor 678
SynonymsMOR32-5, GA_x6K02T2PBJ9-7698491-7699432
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #RF015 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location105064475-105071639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105070048 bp
Amino Acid Change Isoleucine to Valine at position 194 (I194V)
Ref Sequence ENSEMBL: ENSMUSP00000150213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098160] [ENSMUST00000213622]
Predicted Effect probably damaging
Transcript: ENSMUST00000098160
AA Change: I194V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095763
Gene: ENSMUSG00000073913
AA Change: I194V

Pfam:7tm_4 33 311 2.2e-115 PFAM
Pfam:7TM_GPCR_Srsx 37 212 2.8e-6 PFAM
Pfam:7tm_1 43 293 8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213622
AA Change: I194V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Olfr678
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Olfr678 APN 7 105069601 missense probably benign 0.44
IGL01469:Olfr678 APN 7 105070388 missense probably benign 0.05
IGL01726:Olfr678 APN 7 105069629 missense probably damaging 1.00
IGL03263:Olfr678 APN 7 105070002 missense probably damaging 1.00
R1423:Olfr678 UTSW 7 105070019 missense probably damaging 1.00
R2181:Olfr678 UTSW 7 105070211 missense possibly damaging 0.88
R4594:Olfr678 UTSW 7 105069590 missense probably benign 0.00
R5376:Olfr678 UTSW 7 105070357 missense probably damaging 1.00
R5782:Olfr678 UTSW 7 105069749 missense probably damaging 1.00
R5847:Olfr678 UTSW 7 105069857 missense probably benign 0.01
R6418:Olfr678 UTSW 7 105070307 missense probably damaging 1.00
R6664:Olfr678 UTSW 7 105070188 missense possibly damaging 0.64
R7593:Olfr678 UTSW 7 105069497 missense probably benign 0.27
R8813:Olfr678 UTSW 7 105070311 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04