Incidental Mutation 'RF015:Maml2'
ID 603482
Institutional Source Beutler Lab
Gene Symbol Maml2
Ensembl Gene ENSMUSG00000031925
Gene Name mastermind like transcriptional coactivator 2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF015 (G1)
Quality Score 214.458
Status Not validated
Chromosome 9
Chromosomal Location 13297957-13709388 bp(+) (GRCm38)
Type of Mutation small deletion (2 aa in frame mutation)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034401] [ENSMUST00000159294]
AlphaFold F6U238
Predicted Effect probably benign
Transcript: ENSMUST00000034401
SMART Domains Protein: ENSMUSP00000034401
Gene: ENSMUSG00000031925

low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159294
SMART Domains Protein: ENSMUSP00000124083
Gene: ENSMUSG00000031925

low complexity region 227 245 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
SCOP:d1lsha3 385 459 5e-3 SMART
low complexity region 523 547 N/A INTRINSIC
low complexity region 571 589 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 734 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175351
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Maml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Maml2 APN 9 13621604 unclassified probably benign
IGL00424:Maml2 APN 9 13620912 missense probably damaging 0.99
IGL02711:Maml2 APN 9 13620063 missense probably benign 0.14
IGL03079:Maml2 APN 9 13621616 unclassified probably benign
IGL03217:Maml2 APN 9 13619999 missense probably damaging 1.00
FR4304:Maml2 UTSW 9 13621459 small deletion probably benign
FR4449:Maml2 UTSW 9 13621456 small deletion probably benign
PIT4810001:Maml2 UTSW 9 13620024 missense
R0102:Maml2 UTSW 9 13705932 synonymous silent
R0318:Maml2 UTSW 9 13620594 missense probably damaging 0.99
R0380:Maml2 UTSW 9 13621100 nonsense probably null
R1433:Maml2 UTSW 9 13706501 missense probably damaging 1.00
R1449:Maml2 UTSW 9 13620684 missense possibly damaging 0.85
R1789:Maml2 UTSW 9 13697345 missense probably damaging 1.00
R2173:Maml2 UTSW 9 13621616 unclassified probably benign
R2363:Maml2 UTSW 9 13621245 missense probably damaging 1.00
R2426:Maml2 UTSW 9 13706498 missense probably damaging 1.00
R2880:Maml2 UTSW 9 13620597 splice site probably null
R3981:Maml2 UTSW 9 13621068 missense possibly damaging 0.80
R4094:Maml2 UTSW 9 13620153 missense probably benign 0.22
R4117:Maml2 UTSW 9 13705934 missense probably damaging 1.00
R4282:Maml2 UTSW 9 13620110 missense possibly damaging 0.93
R4618:Maml2 UTSW 9 13620075 missense probably damaging 1.00
R4921:Maml2 UTSW 9 13621175 missense probably damaging 1.00
R4957:Maml2 UTSW 9 13620276 missense probably damaging 1.00
R5195:Maml2 UTSW 9 13621114 missense probably damaging 0.98
R5428:Maml2 UTSW 9 13705895 missense probably benign 0.30
R5448:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5450:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5455:Maml2 UTSW 9 13705743 nonsense probably null
R5620:Maml2 UTSW 9 13697320 missense probably damaging 1.00
R5973:Maml2 UTSW 9 13621619 unclassified probably benign
R6009:Maml2 UTSW 9 13620998 missense probably benign 0.02
R6054:Maml2 UTSW 9 13621399 small deletion probably benign
R6257:Maml2 UTSW 9 13620426 missense probably damaging 1.00
R6727:Maml2 UTSW 9 13621551 unclassified probably benign
R6824:Maml2 UTSW 9 13697217 missense possibly damaging 0.67
R6854:Maml2 UTSW 9 13705835 missense possibly damaging 0.59
R6998:Maml2 UTSW 9 13621185 unclassified probably benign
R7047:Maml2 UTSW 9 13620881 unclassified probably benign
R7233:Maml2 UTSW 9 13620771 missense
R7326:Maml2 UTSW 9 13621607 missense
R7612:Maml2 UTSW 9 13706485 missense probably benign 0.04
R7652:Maml2 UTSW 9 13621649 missense
R7699:Maml2 UTSW 9 13621089 missense
R7700:Maml2 UTSW 9 13621089 missense
R7803:Maml2 UTSW 9 13621254 small insertion probably benign
R7803:Maml2 UTSW 9 13621275 small insertion probably benign
R7803:Maml2 UTSW 9 13621276 small insertion probably benign
R8425:Maml2 UTSW 9 13620117 missense
R8810:Maml2 UTSW 9 13621622 missense
R9277:Maml2 UTSW 9 13620576 missense
R9359:Maml2 UTSW 9 13621673 nonsense probably null
R9403:Maml2 UTSW 9 13621673 nonsense probably null
RF044:Maml2 UTSW 9 13621456 small deletion probably benign
X0063:Maml2 UTSW 9 13620341 missense probably benign 0.09
Z1177:Maml2 UTSW 9 13706590 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04