Incidental Mutation 'RF015:Rnf41'
ID603493
Institutional Source Beutler Lab
Gene Symbol Rnf41
Ensembl Gene ENSMUSG00000025373
Gene Namering finger protein 41
SynonymsFLRF, Nrdp1, 4930511A05Rik, D10Ertd722e, 2210404G21Rik, 4933415P08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF015 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128411657-128441441 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128435410 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 63 (A63V)
Ref Sequence ENSEMBL: ENSMUSP00000100869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096386] [ENSMUST00000171342] [ENSMUST00000217826] [ENSMUST00000218371]
PDB Structure Crystal structure of the C-terminal domain of mouse Nrdp1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000096386
AA Change: A63V

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100869
Gene: ENSMUSG00000025373
AA Change: A63V

DomainStartEndE-ValueType
RING 18 56 1.54e-5 SMART
Pfam:USP8_interact 137 315 5.1e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171342
AA Change: A63V

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132751
Gene: ENSMUSG00000025373
AA Change: A63V

DomainStartEndE-ValueType
RING 18 56 1.54e-5 SMART
Pfam:USP8_interact 137 315 2.3e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217826
Predicted Effect probably benign
Transcript: ENSMUST00000218371
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase. The encoded protein plays a role in type 1 cytokine receptor signaling by controlling the balance between JAK2-associated cytokine receptor degradation and ectodomain shedding. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
5430401F13Rik CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,856 probably benign Het
5430401F13Rik AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,859 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,861 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Cyb5r4 CTGCCCAGGGA CTGCCCAGGGATGTGACAGACACATTGCCCAGGGA 9: 87,040,438 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Dnmt1 GGAGCACAGTTCCTACCTCGTT GGAGCACAGTTCCTACCTCGTTTTGGGGGCTGAGCACAGTTCCTACCTCGTT 9: 20,910,124 probably null Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGGGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Slc26a8 TCTCTGGCTCTGGCTCTGGCTCTGGCTC TCTCTGGCTCTGGCTCTGGCTC 17: 28,638,341 probably benign Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Usp2 TGTGACCTGTTCTTCACTTAC TGTGACCTGTTCTTCACTTACTCACGTGACCTGTTCTTCACTTAC 9: 44,089,109 probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Rnf41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01885:Rnf41 APN 10 128435475 missense probably damaging 1.00
IGL02245:Rnf41 APN 10 128437327 makesense probably null
IGL03382:Rnf41 APN 10 128438280 missense possibly damaging 0.91
R0158:Rnf41 UTSW 10 128438235 missense probably damaging 1.00
R1163:Rnf41 UTSW 10 128438207 missense probably benign
R1396:Rnf41 UTSW 10 128435571 missense probably benign
R1690:Rnf41 UTSW 10 128435460 missense possibly damaging 0.70
R2860:Rnf41 UTSW 10 128438154 missense possibly damaging 0.85
R2861:Rnf41 UTSW 10 128438154 missense possibly damaging 0.85
R2862:Rnf41 UTSW 10 128438154 missense possibly damaging 0.85
R4382:Rnf41 UTSW 10 128436523 missense probably benign 0.33
R7477:Rnf41 UTSW 10 128435434 missense probably damaging 0.99
R7492:Rnf41 UTSW 10 128438414 missense probably damaging 1.00
R8524:Rnf41 UTSW 10 128435430 missense possibly damaging 0.93
R8560:Rnf41 UTSW 10 128438353 nonsense probably null
R8691:Rnf41 UTSW 10 128438208 missense probably benign 0.24
X0021:Rnf41 UTSW 10 128437395 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCAGGCTTCATTGGCTTC -3'
(R):5'- GAAGGCCCATGTCTGAATGG -3'

Sequencing Primer
(F):5'- GCAGGCTTCATTGGCTTCATAATTAC -3'
(R):5'- TGGAAGGAGGAATCTCACCCAC -3'
Posted On2019-12-04