Incidental Mutation 'RF015:Utp18'
ID 603495
Institutional Source Beutler Lab
Gene Symbol Utp18
Ensembl Gene ENSMUSG00000054079
Gene Name UTP18 small subunit processome component
Synonyms 6230425C22Rik, Wdr50
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock # RF015 (G1)
Quality Score 205.009
Status Not validated
Chromosome 11
Chromosomal Location 93859243-93885766 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93885461 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 66 (L66P)
Ref Sequence ENSEMBL: ENSMUSP00000068103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063645] [ENSMUST00000063718] [ENSMUST00000066888] [ENSMUST00000107850] [ENSMUST00000107853] [ENSMUST00000107854]
AlphaFold Q5SSI6
Predicted Effect probably benign
Transcript: ENSMUST00000063645
SMART Domains Protein: ENSMUSP00000070248
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 7e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 459 1.61e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063718
SMART Domains Protein: ENSMUSP00000065442
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
PDB:2W0T|A 74 96 7e-6 PDB
low complexity region 97 112 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
MBT 166 270 3.11e-22 SMART
MBT 278 379 1.28e-41 SMART
MBT 383 481 1.61e-38 SMART
MBT 489 585 4.11e-54 SMART
low complexity region 586 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066888
AA Change: L66P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068103
Gene: ENSMUSG00000054079
AA Change: L66P

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 100 111 N/A INTRINSIC
low complexity region 139 146 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
WD40 236 275 7.4e0 SMART
WD40 280 320 3.08e0 SMART
Blast:WD40 325 365 4e-17 BLAST
WD40 368 406 2.23e-1 SMART
WD40 409 449 1.78e0 SMART
WD40 458 499 2.05e1 SMART
WD40 510 545 7.92e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107850
SMART Domains Protein: ENSMUSP00000103482
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
Blast:MBT 25 52 2e-9 BLAST
PDB:2W0T|A 52 74 2e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
PDB:4C5I|B 131 201 5e-37 PDB
Blast:MBT 144 201 1e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107853
SMART Domains Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.8e-44 SMART
MBT 361 459 6.1e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107854
SMART Domains Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.9e-44 SMART
MBT 361 459 6.2e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
5430401F13Rik CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,856 probably benign Het
5430401F13Rik AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,859 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,861 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Cyb5r4 CTGCCCAGGGA CTGCCCAGGGATGTGACAGACACATTGCCCAGGGA 9: 87,040,438 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Dnmt1 GGAGCACAGTTCCTACCTCGTT GGAGCACAGTTCCTACCTCGTTTTGGGGGCTGAGCACAGTTCCTACCTCGTT 9: 20,910,124 probably null Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGGGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Slc26a8 TCTCTGGCTCTGGCTCTGGCTCTGGCTC TCTCTGGCTCTGGCTCTGGCTC 17: 28,638,341 probably benign Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Usp2 TGTGACCTGTTCTTCACTTAC TGTGACCTGTTCTTCACTTACTCACGTGACCTGTTCTTCACTTAC 9: 44,089,109 probably benign Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Utp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Utp18 APN 11 93869848 missense possibly damaging 0.95
IGL02061:Utp18 APN 11 93882141 missense probably benign 0.05
IGL02402:Utp18 APN 11 93883791 unclassified probably benign
IGL02552:Utp18 APN 11 93868334 missense probably damaging 0.97
IGL03086:Utp18 APN 11 93876056 missense probably damaging 1.00
IGL03090:Utp18 APN 11 93868419 missense probably damaging 1.00
IGL03281:Utp18 APN 11 93875958 missense probably damaging 1.00
R0042:Utp18 UTSW 11 93875858 missense probably damaging 0.99
R0281:Utp18 UTSW 11 93882177 unclassified probably benign
R0399:Utp18 UTSW 11 93880147 splice site probably benign
R0543:Utp18 UTSW 11 93875835 missense probably damaging 1.00
R1512:Utp18 UTSW 11 93885564 missense probably benign 0.00
R1674:Utp18 UTSW 11 93876053 critical splice donor site probably null
R2013:Utp18 UTSW 11 93876122 missense possibly damaging 0.91
R4426:Utp18 UTSW 11 93866438 missense probably damaging 1.00
R4427:Utp18 UTSW 11 93866438 missense probably damaging 1.00
R4455:Utp18 UTSW 11 93885447 missense probably benign 0.09
R4458:Utp18 UTSW 11 93870533 missense possibly damaging 0.92
R5085:Utp18 UTSW 11 93870537 missense possibly damaging 0.78
R5297:Utp18 UTSW 11 93876089 missense probably damaging 0.99
R5321:Utp18 UTSW 11 93866434 missense probably damaging 1.00
R6006:Utp18 UTSW 11 93885623 missense probably benign 0.00
R6845:Utp18 UTSW 11 93885756 unclassified probably benign
R7211:Utp18 UTSW 11 93885380 missense probably benign 0.01
R7330:Utp18 UTSW 11 93882073 critical splice donor site probably null
R8193:Utp18 UTSW 11 93876077 missense probably damaging 1.00
R9523:Utp18 UTSW 11 93878007 missense probably damaging 1.00
Z1177:Utp18 UTSW 11 93875821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAAGCCGACAGTTGAG -3'
(R):5'- ACATGCGCAGTGGTACTC -3'

Sequencing Primer
(F):5'- GCCTGCTGGATGCGAAG -3'
(R):5'- CGAACGCAAGAGCCGGAC -3'
Posted On 2019-12-04