Incidental Mutation 'RF015:Cep131'
ID603497
Institutional Source Beutler Lab
Gene Symbol Cep131
Ensembl Gene ENSMUSG00000039781
Gene Namecentrosomal protein 131
SynonymsAzi1, AZ1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #RF015 (G1)
Quality Score214.458
Status Not validated
Chromosome11
Chromosomal Location120064430-120086827 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) CTGTTGTT to CTGTTGTTGTT at 120072968 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106227] [ENSMUST00000106229] [ENSMUST00000180242]
Predicted Effect probably benign
Transcript: ENSMUST00000106227
SMART Domains Protein: ENSMUSP00000101834
Gene: ENSMUSG00000039781

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 344 N/A INTRINSIC
low complexity region 395 409 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
SCOP:d1jila_ 672 756 2e-3 SMART
low complexity region 785 803 N/A INTRINSIC
low complexity region 813 826 N/A INTRINSIC
coiled coil region 874 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106229
SMART Domains Protein: ENSMUSP00000101836
Gene: ENSMUSG00000039781

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 342 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180242
SMART Domains Protein: ENSMUSP00000136392
Gene: ENSMUSG00000039781

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 345 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoding this gene is a centriolar satellite protein that localizes around the basal body via transport along microtubules. Knockdown in mouse fibroblasts results in a reduction in ciliogenesis. Null mutant mice display no discernible ciliary phenotypes and embryonic patterning and adult homeostasis are largely unaffected. Male mice are infertile, however, due to defects in microtubule trafficking in the sperm manchette and flagella. In addition, the protein binds to a complex of proteins associated with Bardet-Biedl syndrome called the BBSome, and depletion of this protein results in an accumulation of the BBSome in cilia. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit partial preweaning lethality with no apparent defects in cilia formation or function. However, homozygotes display complete male infertility associated with spermiogenesis arrest, severe flagellar defects, and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
5430401F13Rik CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,856 probably benign Het
5430401F13Rik AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,859 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,861 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Cyb5r4 CTGCCCAGGGA CTGCCCAGGGATGTGACAGACACATTGCCCAGGGA 9: 87,040,438 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Dnmt1 GGAGCACAGTTCCTACCTCGTT GGAGCACAGTTCCTACCTCGTTTTGGGGGCTGAGCACAGTTCCTACCTCGTT 9: 20,910,124 probably null Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGGGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Slc26a8 TCTCTGGCTCTGGCTCTGGCTCTGGCTC TCTCTGGCTCTGGCTCTGGCTC 17: 28,638,341 probably benign Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Usp2 TGTGACCTGTTCTTCACTTAC TGTGACCTGTTCTTCACTTACTCACGTGACCTGTTCTTCACTTAC 9: 44,089,109 probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Cep131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Cep131 APN 11 120077009 missense possibly damaging 0.55
IGL01522:Cep131 APN 11 120067163 missense probably benign 0.09
IGL01524:Cep131 APN 11 120065960 missense probably damaging 1.00
IGL02477:Cep131 APN 11 120070580 missense probably damaging 1.00
R0565:Cep131 UTSW 11 120073762 missense probably damaging 0.97
R1731:Cep131 UTSW 11 120076916 splice site probably null
R1739:Cep131 UTSW 11 120083906 missense probably benign 0.01
R1797:Cep131 UTSW 11 120073736 splice site probably null
R2444:Cep131 UTSW 11 120070495 missense probably damaging 1.00
R2899:Cep131 UTSW 11 120072028 missense probably benign 0.01
R3854:Cep131 UTSW 11 120067185 nonsense probably null
R3856:Cep131 UTSW 11 120067185 nonsense probably null
R4446:Cep131 UTSW 11 120064819 missense probably damaging 1.00
R4624:Cep131 UTSW 11 120070832 missense probably damaging 1.00
R4838:Cep131 UTSW 11 120076156 missense probably damaging 1.00
R4892:Cep131 UTSW 11 120068057 missense probably damaging 0.99
R5170:Cep131 UTSW 11 120070609 missense probably damaging 0.99
R6128:Cep131 UTSW 11 120065975 missense probably damaging 1.00
R6179:Cep131 UTSW 11 120066011 missense probably benign 0.13
R6362:Cep131 UTSW 11 120064690 missense probably damaging 0.99
R6630:Cep131 UTSW 11 120073815 missense probably damaging 1.00
R6786:Cep131 UTSW 11 120065392 missense probably damaging 1.00
R6846:Cep131 UTSW 11 120065691 missense probably damaging 1.00
R6847:Cep131 UTSW 11 120065691 missense probably damaging 1.00
R7210:Cep131 UTSW 11 120064789 missense probably damaging 0.96
R7569:Cep131 UTSW 11 120066713 missense probably damaging 1.00
R8380:Cep131 UTSW 11 120077028 missense probably damaging 1.00
R8794:Cep131 UTSW 11 120081248 missense probably benign 0.01
RF054:Cep131 UTSW 11 120072968 critical splice acceptor site probably benign
Z1177:Cep131 UTSW 11 120065715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCACCTCACTGTAGGCC -3'
(R):5'- GAACCTTCTGGAACTGCACC -3'

Sequencing Primer
(F):5'- TCACTGTAGGCCTCCCAG -3'
(R):5'- AAAAGGCTCGTCAGGCC -3'
Posted On2019-12-04