Incidental Mutation 'RF015:Skor2'
ID603510
Institutional Source Beutler Lab
Gene Symbol Skor2
Ensembl Gene ENSMUSG00000091519
Gene NameSKI family transcriptional corepressor 2
SynonymsGm7348, Fussel18, Corl2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF015 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location76856405-76900342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76860788 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 735 (E735G)
Ref Sequence ENSEMBL: ENSMUSP00000132338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166956]
Predicted Effect probably damaging
Transcript: ENSMUST00000166956
AA Change: E735G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132338
Gene: ENSMUSG00000091519
AA Change: E735G

DomainStartEndE-ValueType
Pfam:Ski_Sno 25 132 2.3e-41 PFAM
c-SKI_SMAD_bind 144 236 6.92e-55 SMART
low complexity region 261 305 N/A INTRINSIC
low complexity region 320 373 N/A INTRINSIC
low complexity region 426 452 N/A INTRINSIC
low complexity region 478 491 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
low complexity region 645 680 N/A INTRINSIC
low complexity region 688 707 N/A INTRINSIC
low complexity region 722 741 N/A INTRINSIC
low complexity region 747 766 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal and postnatal lethality, abnormal cerebellum development, and abnormal Purkinje cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
5430401F13Rik CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,856 probably benign Het
5430401F13Rik AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,859 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,861 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG 19: 47,141,256 probably benign Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Cyb5r4 CTGCCCAGGGA CTGCCCAGGGATGTGACAGACACATTGCCCAGGGA 9: 87,040,438 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Dnmt1 GGAGCACAGTTCCTACCTCGTT GGAGCACAGTTCCTACCTCGTTTTGGGGGCTGAGCACAGTTCCTACCTCGTT 9: 20,910,124 probably null Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGGGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Slc26a8 TCTCTGGCTCTGGCTCTGGCTCTGGCTC TCTCTGGCTCTGGCTCTGGCTC 17: 28,638,341 probably benign Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Usp2 TGTGACCTGTTCTTCACTTAC TGTGACCTGTTCTTCACTTACTCACGTGACCTGTTCTTCACTTAC 9: 44,089,109 probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Skor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Skor2 APN 18 76858667 missense unknown
IGL01604:Skor2 APN 18 76859951 missense possibly damaging 0.93
IGL02306:Skor2 APN 18 76862679 missense probably benign 0.01
IGL03287:Skor2 APN 18 76876135 missense probably damaging 0.99
R0225:Skor2 UTSW 18 76859098 missense unknown
R0265:Skor2 UTSW 18 76876598 missense probably damaging 0.99
R0650:Skor2 UTSW 18 76876560 missense probably benign 0.32
R1086:Skor2 UTSW 18 76859299 missense unknown
R1237:Skor2 UTSW 18 76876132 nonsense probably null
R1465:Skor2 UTSW 18 76876645 splice site probably benign
R1625:Skor2 UTSW 18 76858804 missense unknown
R1682:Skor2 UTSW 18 76859516 missense unknown
R1918:Skor2 UTSW 18 76859356 missense unknown
R2878:Skor2 UTSW 18 76860724 nonsense probably null
R3103:Skor2 UTSW 18 76859278 nonsense probably null
R3611:Skor2 UTSW 18 76858838 missense unknown
R3882:Skor2 UTSW 18 76862689 missense probably damaging 0.97
R3891:Skor2 UTSW 18 76858655 missense unknown
R4473:Skor2 UTSW 18 76859461 missense unknown
R4720:Skor2 UTSW 18 76861183 critical splice donor site probably null
R4828:Skor2 UTSW 18 76860418 missense probably damaging 1.00
R4906:Skor2 UTSW 18 76860295 missense possibly damaging 0.73
R5074:Skor2 UTSW 18 76858954 nonsense probably null
R5486:Skor2 UTSW 18 76858700 missense unknown
R5729:Skor2 UTSW 18 76858883 missense unknown
R5886:Skor2 UTSW 18 76859429 missense unknown
R6017:Skor2 UTSW 18 76858927 missense unknown
R6514:Skor2 UTSW 18 76862694 missense probably damaging 1.00
R6565:Skor2 UTSW 18 76859912 missense possibly damaging 0.70
R6909:Skor2 UTSW 18 76860557 missense possibly damaging 0.68
R7169:Skor2 UTSW 18 76860986 missense probably benign 0.04
R7171:Skor2 UTSW 18 76860986 missense probably benign 0.04
R7188:Skor2 UTSW 18 76859809 missense possibly damaging 0.53
R7219:Skor2 UTSW 18 76860401 missense possibly damaging 0.96
R7548:Skor2 UTSW 18 76860905 missense possibly damaging 0.82
R7722:Skor2 UTSW 18 76862644 missense probably benign 0.09
R7923:Skor2 UTSW 18 76858721 missense unknown
R8125:Skor2 UTSW 18 76859678 missense unknown
R8255:Skor2 UTSW 18 76858969 missense unknown
R8531:Skor2 UTSW 18 76858874 missense unknown
R8548:Skor2 UTSW 18 76858886 missense unknown
Z1176:Skor2 UTSW 18 76860124 missense probably benign 0.15
Z1176:Skor2 UTSW 18 76860670 missense possibly damaging 0.93
Z1176:Skor2 UTSW 18 76861161 missense probably damaging 0.99
Z1177:Skor2 UTSW 18 76876093 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAAGCCTGGCCAAGCTG -3'
(R):5'- TGGAGGAGTTCAGCGCTAG -3'

Sequencing Primer
(F):5'- GTCGCCACTGCTGCTGTTG -3'
(R):5'- TTCAGCGCTAGAGGGAAAGCAC -3'
Posted On2019-12-04