Incidental Mutation 'RF015:Calhm1'
ID603511
Institutional Source Beutler Lab
Gene Symbol Calhm1
Ensembl Gene ENSMUSG00000079258
Gene Namecalcium homeostasis modulator 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF015 (G1)
Quality Score217.523
Status Not validated
Chromosome19
Chromosomal Location47141035-47144174 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TGGCTGTGGCTG to TGGCTGTGGCTGGGGCTGTGGCTG at 47141256 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035822] [ENSMUST00000111813] [ENSMUST00000140512]
Predicted Effect probably benign
Transcript: ENSMUST00000035822
SMART Domains Protein: ENSMUSP00000047278
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 256 2.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111813
SMART Domains Protein: ENSMUSP00000107444
Gene: ENSMUSG00000079258

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 255 5.6e-94 PFAM
low complexity region 267 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cortical neuron electrical properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT 3: 37,050,748 probably benign Het
5430401F13Rik CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,856 probably benign Het
5430401F13Rik AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,859 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,861 probably benign Het
Abcb4 GAA G 5: 8,896,594 probably null Het
Agap1 T A 1: 89,634,263 Y214* probably null Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Arid1a AGGC A 4: 133,752,831 probably benign Het
Bco2 A G 9: 50,545,997 F82L probably damaging Het
Capn9 T C 8: 124,618,482 F683L probably benign Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Cgnl1 AGCG AGCGGCG 9: 71,724,715 probably benign Het
Chga AGC AGCGGC 12: 102,561,420 probably benign Het
Cyb5r4 GACACA GACACAGTGCCCAAGGATGTGACATACACA 9: 87,040,432 probably benign Het
Cyb5r4 CTGCCCAGGGA CTGCCCAGGGATGTGACAGACACATTGCCCAGGGA 9: 87,040,438 probably benign Het
Dnah10 G A 5: 124,818,077 D3557N probably damaging Het
Dnmt1 GGAGCACAGTTCCTACCTCGTT GGAGCACAGTTCCTACCTCGTTTTGGGGGCTGAGCACAGTTCCTACCTCGTT 9: 20,910,124 probably null Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGGGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Fam49a T A 12: 12,369,938 S294R probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Gatad1 A T 5: 3,647,523 C33S possibly damaging Het
Gm7534 T C 4: 134,193,027 H609R probably benign Het
H2-DMb1 A G 17: 34,155,502 Y42C probably damaging Het
Hars2 G T 18: 36,785,945 R86L probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCGGCCAC 3: 93,018,148 probably benign Het
Lrmp AGCACATTG AGCACATTGCGCACATTG 6: 145,173,783 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,841 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Het
Mucl2 T A 15: 103,897,430 N87I probably benign Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Nup214 T C 2: 32,034,706 V1749A probably benign Het
Olfr678 A G 7: 105,070,048 I194V probably damaging Het
Pcdhgb4 A T 18: 37,721,802 N417Y probably damaging Het
Pclo G T 5: 14,515,269 L16F unknown Het
Pik3c2g T A 6: 139,754,771 N262K Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Rfx4 CTCTCT CTCTCTCTCTCTCTCTTTCTCT 10: 84,858,489 probably benign Het
Rnf41 C T 10: 128,435,410 A63V probably benign Het
Sirt1 C T 10: 63,337,016 A163T probably damaging Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Six4 TG T 12: 73,103,582 probably null Het
Skor2 A G 18: 76,860,788 E735G probably damaging Het
Slc26a8 TCTCTGGCTCTGGCTCTGGCTCTGGCTC TCTCTGGCTCTGGCTCTGGCTC 17: 28,638,341 probably benign Het
Smco2 T TTCG 6: 146,852,663 probably benign Het
Strada A G 11: 106,171,020 I172T probably damaging Het
Syne1 T C 10: 5,302,248 I2469V probably benign Het
Tcof1 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA 18: 60,833,584 probably benign Het
Tram1 T C 1: 13,579,742 Y86C probably damaging Het
Ttll7 T A 3: 146,979,658 F882L probably benign Het
Usp2 TGTGACCTGTTCTTCACTTAC TGTGACCTGTTCTTCACTTACTCACGTGACCTGTTCTTCACTTAC 9: 44,089,109 probably benign Het
Utp18 A G 11: 93,885,461 L66P probably damaging Het
Wdr66 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG 5: 123,254,242 probably benign Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wnt7a C T 6: 91,394,423 E186K possibly damaging Het
Zfp384 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC 6: 125,036,481 probably benign Het
Zgrf1 A G 3: 127,563,233 I703V probably benign Het
Other mutations in Calhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Calhm1 UTSW 19 47141251 unclassified probably benign
FR4449:Calhm1 UTSW 19 47141274 unclassified probably benign
FR4976:Calhm1 UTSW 19 47141262 unclassified probably benign
R0328:Calhm1 UTSW 19 47141303 missense possibly damaging 0.46
R0402:Calhm1 UTSW 19 47141457 missense probably damaging 0.98
R0463:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R0608:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R1552:Calhm1 UTSW 19 47141201 missense probably benign 0.00
R4647:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R4648:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R5762:Calhm1 UTSW 19 47143619 splice site probably null
R5766:Calhm1 UTSW 19 47143703 missense probably benign 0.00
RF001:Calhm1 UTSW 19 47141276 unclassified probably benign
RF010:Calhm1 UTSW 19 47141273 unclassified probably benign
RF014:Calhm1 UTSW 19 47141265 unclassified probably benign
RF023:Calhm1 UTSW 19 47141273 unclassified probably benign
RF025:Calhm1 UTSW 19 47141276 unclassified probably benign
RF025:Calhm1 UTSW 19 47141277 unclassified probably benign
RF030:Calhm1 UTSW 19 47141253 unclassified probably benign
RF032:Calhm1 UTSW 19 47141283 frame shift probably null
RF035:Calhm1 UTSW 19 47141253 unclassified probably benign
RF036:Calhm1 UTSW 19 47141277 unclassified probably benign
RF040:Calhm1 UTSW 19 47141277 unclassified probably benign
RF050:Calhm1 UTSW 19 47141270 unclassified probably benign
RF057:Calhm1 UTSW 19 47141270 unclassified probably benign
RF063:Calhm1 UTSW 19 47141256 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTAGGTGGCCACTTCCTTG -3'
(R):5'- GCCTTTCTCAAGAGCAAGTACTG -3'

Sequencing Primer
(F):5'- ACTTCCTTGCGTGGAGGC -3'
(R):5'- GGTCCCACTACATTGACATTGAG -3'
Posted On2019-12-04