Incidental Mutation 'RF016:Unc13b'
ID603531
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Nameunc-13 homolog B (C. elegans)
SynonymsUnc13h2, Munc13-2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #RF016 (G1)
Quality Score108.467
Status Not validated
Chromosome4
Chromosomal Location43058953-43264871 bp(+) (GRCm38)
Type of Mutationsmall insertion (6 aa in frame mutation)
DNA Base Change (assembly) CAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC to CAGAGCCAGAGCCAGAGCGAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC at 43177347 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569]
Predicted Effect probably benign
Transcript: ENSMUST00000079978
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163653
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168032
SMART Domains Protein: ENSMUSP00000132622
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C1 147 196 4.21e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207569
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGCTGTGGC TGCTGTGGCGGCTGTGGC 1: 82,913,577 probably benign Het
Abi3bp GCCCACGACCC GCCCACGACCCACGACCC 16: 56,627,587 probably null Het
Amer3 A G 1: 34,587,120 I147V probably damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,909 probably benign Het
Ankhd1 GCGGCG GCGGCGACGGCG 18: 36,560,910 probably benign Het
Ankzf1 G A 1: 75,195,833 R259H probably damaging Het
Apol9b T C 15: 77,735,514 V170A probably benign Het
Asb3 A G 11: 31,061,407 I267M possibly damaging Het
Baz2a A G 10: 128,125,316 E1636G probably benign Het
Birc6 G T 17: 74,689,324 V4513F probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Ccdc27 T C 4: 154,036,110 R410G probably benign Het
Cdhr5 A G 7: 141,272,184 V435A possibly damaging Het
Cercam T C 2: 29,869,305 S15P unknown Het
Cntrl T C 2: 35,119,986 V224A probably benign Het
Comtd1 T A 14: 21,848,596 Q56L probably benign Het
Cul9 CCT CCTACT 17: 46,500,863 probably null Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGA TGTGACAGACACACTGCCCAGGGACGTGACAGACACACTGCCCAGGGA 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGACAGACACACTGACCAGGGA 9: 87,040,441 probably benign Het
Cyb5r4 AGGGA AGGGATGGGACAGACCCACTGCCCCGGGA 9: 87,040,444 probably benign Het
Cyld T A 8: 88,705,441 Y22* probably null Het
Dbt T C 3: 116,539,714 Y278H probably damaging Het
Ddb1 A G 19: 10,627,858 H1070R probably damaging Het
Dek G T 13: 47,098,186 S248* probably null Het
Dixdc1 T C 9: 50,693,641 T300A probably benign Het
Dusp8 A T 7: 142,082,852 S334T probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Ehbp1 T C 11: 22,146,646 N306S probably benign Het
Fcer1a T C 1: 173,225,519 I37V possibly damaging Het
Fgfr2 G T 7: 130,177,680 Q639K probably benign Het
Gab3 CTT CTTATT X: 74,999,985 probably null Het
Gins4 T C 8: 23,232,610 M98V probably benign Het
Gm35339 A T 15: 76,355,972 I331F Het
Gm813 T A 16: 58,616,867 N26I probably damaging Het
Gm8369 GTGTGTGT GTGTGTGTTTGTGTGT 19: 11,511,754 probably null Het
Grik1 G A 16: 88,034,186 S232L Het
Gsg1l A G 7: 126,020,622 probably null Het
H13 G A 2: 152,669,669 E30K probably damaging Het
H2-DMb1 A T 17: 34,157,386 S160C probably damaging Het
Hsdl2 GCAGCCACAGCTGCAG GCAGCCACAGCTGCAGCATCAGCCACAGCTGCAG 4: 59,610,643 probably benign Het
Iqcf4 TTTCCTTTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTGTTCCTTTTCCTTTT 9: 106,570,609 probably benign Het
Jag1 T A 2: 137,096,256 T275S probably benign Het
Klhdc2 T A 12: 69,303,886 I158K probably damaging Het
Krtap28-10 TCCC TCCCGCACCC 1: 83,042,123 probably benign Het
Lrp2 T A 2: 69,509,205 M1121L probably benign Het
M6pr C T 6: 122,315,165 A152V probably damaging Het
Mapkapk5 T C 5: 121,533,316 Y218C probably damaging Het
Mkrn1 C T 6: 39,419,991 V26I Het
Mro CA CAAACTCGGA 18: 73,869,964 probably null Het
Mrpl3 T C 9: 105,075,253 V303A probably benign Het
Nefh CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,022 probably benign Het
Nefh TCACCTGGGGACT TCACCTGGGGACTCGGCCCCACCTGGGGACT 11: 4,941,023 probably benign Het
Nid2 GGCTAACACCGC GGC 14: 19,751,363 probably benign Het
Nusap1 CAAGCTGAGA CAAGCTGAGATACACGTTAGCAGTGAGGAGAAAGCTGAGA 2: 119,627,601 probably benign Het
Olfr212 G T 6: 116,516,043 A89S probably benign Het
Olfr964-ps1 A ATAGG 9: 39,686,754 probably null Het
Ovol1 A G 19: 5,553,612 V87A probably benign Het
Pdpk1 T A 17: 24,093,281 E290D probably benign Het
Pkd1l3 T A 8: 109,623,542 S340T probably benign Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,909,609 probably benign Het
Pou3f1 GC GCGGCGCC 4: 124,657,809 probably benign Het
Prp2 AGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGAGACCCCCTCAAGGCCCACCACC 6: 132,600,512 probably benign Het
Prpf6 A G 2: 181,632,076 M338V probably benign Het
Psg28 G T 7: 18,422,922 L463I probably damaging Het
Ptprd T C 4: 76,128,655 D211G probably benign Het
Pus1 T C 5: 110,776,558 H160R not run Het
Ranbp17 T C 11: 33,329,511 T582A probably damaging Het
Rasa1 G A 13: 85,223,488 T878I possibly damaging Het
Rbm20 A G 19: 53,813,732 T224A probably benign Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Sh3bp4 T C 1: 89,145,022 S531P probably benign Het
Sh3pxd2b TGCCTG TGCCTGCGCCTG 11: 32,423,053 probably benign Het
Snrnp200 T C 2: 127,230,556 L1291P probably damaging Het
Sppl2a C T 2: 126,927,774 R54Q probably benign Het
Sulf2 A T 2: 166,082,603 L521Q probably benign Het
Supv3l1 C A 10: 62,437,508 V317F possibly damaging Het
Tcof1 TCC TCCACTTGGCTGCTGAGATGGGCACTTTCCCAGAGACCC 18: 60,833,575 probably benign Het
Thegl CTCCCCAGTCCCGCAAGGCCAG CTCCCCAGTCCCGCAAGGCCAGCGATCATCCCCAGTCCCGCAAGGCCAG 5: 77,016,408 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCCGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,289 probably benign Het
Usp38 A G 8: 81,013,893 S182P probably benign Het
Vmn2r24 T C 6: 123,804,215 V460A probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
R7598:Unc13b UTSW 4 43263569 missense probably benign 0.20
R7604:Unc13b UTSW 4 43170102 missense unknown
R7604:Unc13b UTSW 4 43256776 missense possibly damaging 0.95
R7643:Unc13b UTSW 4 43216333 missense probably benign
R7718:Unc13b UTSW 4 43173854 missense unknown
R7735:Unc13b UTSW 4 43165791 missense probably damaging 1.00
R7756:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177330 small insertion probably benign
R7757:Unc13b UTSW 4 43177341 small insertion probably benign
R7758:Unc13b UTSW 4 43177312 small insertion probably benign
R7758:Unc13b UTSW 4 43177344 small insertion probably benign
R7781:Unc13b UTSW 4 43259546 missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43172737 missense unknown
R7858:Unc13b UTSW 4 43176285 missense unknown
R7867:Unc13b UTSW 4 43232573 nonsense probably null
R7897:Unc13b UTSW 4 43171860 missense unknown
R7904:Unc13b UTSW 4 43217075 missense probably benign
R7941:Unc13b UTSW 4 43176285 missense unknown
R7950:Unc13b UTSW 4 43232573 nonsense probably null
R7980:Unc13b UTSW 4 43171860 missense unknown
R7987:Unc13b UTSW 4 43217075 missense probably benign
R8069:Unc13b UTSW 4 43177597 missense unknown
RF016:Unc13b UTSW 4 43177350 small insertion probably benign
RF041:Unc13b UTSW 4 43177338 small insertion probably benign
RF056:Unc13b UTSW 4 43177359 small insertion probably benign
Z1176:Unc13b UTSW 4 43171419 missense unknown
Z1176:Unc13b UTSW 4 43177191 missense unknown
Z1176:Unc13b UTSW 4 43177764 missense unknown
Z1176:Unc13b UTSW 4 43261043 missense probably benign 0.11
Z1177:Unc13b UTSW 4 43173669 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGAGACATGGGGCTTTTGC -3'
(R):5'- TGGGGCATGATGTATACTAGAAC -3'

Sequencing Primer
(F):5'- TTTTGCAGGGCACAGACAC -3'
(R):5'- ACAGGTTCCTCTTGCAAAGG -3'
Posted On2019-12-04