Incidental Mutation 'RF016:Gins4'
ID 603553
Institutional Source Beutler Lab
Gene Symbol Gins4
Ensembl Gene ENSMUSG00000031546
Gene Name GINS complex subunit 4
Synonyms 2810037C03Rik, SLD5, 4933405K01Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF016 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 23716632-23727675 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23722626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 98 (M98V)
Ref Sequence ENSEMBL: ENSMUSP00000033950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033950]
AlphaFold Q99LZ3
Predicted Effect probably benign
Transcript: ENSMUST00000033950
AA Change: M98V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033950
Gene: ENSMUSG00000031546
AA Change: M98V

DomainStartEndE-ValueType
Pfam:Sld5 20 127 5.3e-9 PFAM
Pfam:SLD5_C 165 223 4.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5, Psf1 (GINS1; MIM 610608), Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]). See GINS1 for additional information about the GINS complex.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant animals do not survive past implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGCTGTGGC TGCTGTGGCGGCTGTGGC 1: 82,891,298 (GRCm39) probably benign Het
Abi3bp GCCCACGACCC GCCCACGACCCACGACCC 16: 56,447,950 (GRCm39) probably null Het
Amer3 A G 1: 34,626,201 (GRCm39) I147V probably damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,962 (GRCm39) probably benign Het
Ankhd1 GCGGCG GCGGCGACGGCG 18: 36,693,963 (GRCm39) probably benign Het
Ankzf1 G A 1: 75,172,477 (GRCm39) R259H probably damaging Het
Apol9b T C 15: 77,619,714 (GRCm39) V170A probably benign Het
Asb3 A G 11: 31,011,407 (GRCm39) I267M possibly damaging Het
Baz2a A G 10: 127,961,185 (GRCm39) E1636G probably benign Het
Birc6 G T 17: 74,996,319 (GRCm39) V4513F probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,162,674 (GRCm39) probably null Het
Ccdc113 G A 8: 96,264,733 (GRCm39) R81H probably benign Het
Ccdc27 T C 4: 154,120,567 (GRCm39) R410G probably benign Het
Cdhr5 A G 7: 140,852,097 (GRCm39) V435A possibly damaging Het
Cercam T C 2: 29,759,317 (GRCm39) S15P unknown Het
Cntrl T C 2: 35,009,998 (GRCm39) V224A probably benign Het
Comtd1 T A 14: 21,898,664 (GRCm39) Q56L probably benign Het
Cul9 CCT CCTACT 17: 46,811,789 (GRCm39) probably null Het
Cyb5r4 AGGGA AGGGATGGGACAGACCCACTGCCCCGGGA 9: 86,922,497 (GRCm39) probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGA TGTGACAGACACACTGCCCAGGGACGTGACAGACACACTGCCCAGGGA 9: 86,922,478 (GRCm39) probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGACAGACACACTGACCAGGGA 9: 86,922,494 (GRCm39) probably benign Het
Cyld T A 8: 89,432,069 (GRCm39) Y22* probably null Het
Dbt T C 3: 116,333,363 (GRCm39) Y278H probably damaging Het
Ddb1 A G 19: 10,605,222 (GRCm39) H1070R probably damaging Het
Dek G T 13: 47,251,662 (GRCm39) S248* probably null Het
Dixdc1 T C 9: 50,604,941 (GRCm39) T300A probably benign Het
Dusp8 A T 7: 141,636,589 (GRCm39) S334T probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,602,067 (GRCm39) probably benign Het
Ehbp1 T C 11: 22,096,646 (GRCm39) N306S probably benign Het
Fcer1a T C 1: 173,053,086 (GRCm39) I37V possibly damaging Het
Fgfr2 G T 7: 129,779,410 (GRCm39) Q639K probably benign Het
Ftdc1 T A 16: 58,437,230 (GRCm39) N26I probably damaging Het
Gab3 CTT CTTATT X: 74,043,591 (GRCm39) probably null Het
Gm8369 GTGTGTGT GTGTGTGTTTGTGTGT 19: 11,489,118 (GRCm39) probably null Het
Grik1 G A 16: 87,831,074 (GRCm39) S232L Het
Gsg1l A G 7: 125,619,794 (GRCm39) probably null Het
H13 G A 2: 152,511,589 (GRCm39) E30K probably damaging Het
H2-DMb1 A T 17: 34,376,360 (GRCm39) S160C probably damaging Het
Hsdl2 GCAGCCACAGCTGCAG GCAGCCACAGCTGCAGCATCAGCCACAGCTGCAG 4: 59,610,643 (GRCm39) probably benign Het
Iqcf4 TTTCCTTTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTGTTCCTTTTCCTTTT 9: 106,447,808 (GRCm39) probably benign Het
Jag1 T A 2: 136,938,176 (GRCm39) T275S probably benign Het
Klhdc2 T A 12: 69,350,660 (GRCm39) I158K probably damaging Het
Krtap28-10 TCCC TCCCGCACCC 1: 83,019,844 (GRCm39) probably benign Het
Lrp2 T A 2: 69,339,549 (GRCm39) M1121L probably benign Het
M6pr C T 6: 122,292,124 (GRCm39) A152V probably damaging Het
Mapkapk5 T C 5: 121,671,379 (GRCm39) Y218C probably damaging Het
Mkrn1 C T 6: 39,396,925 (GRCm39) V26I Het
Mro CA CAAACTCGGA 18: 74,003,035 (GRCm39) probably null Het
Mrpl3 T C 9: 104,952,452 (GRCm39) V303A probably benign Het
Nefh CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,022 (GRCm39) probably benign Het
Nefh TCACCTGGGGACT TCACCTGGGGACTCGGCCCCACCTGGGGACT 11: 4,891,023 (GRCm39) probably benign Het
Nid2 GGCTAACACCGC GGC 14: 19,801,431 (GRCm39) probably benign Het
Nusap1 CAAGCTGAGA CAAGCTGAGATACACGTTAGCAGTGAGGAGAAAGCTGAGA 2: 119,458,082 (GRCm39) probably benign Het
Or10n7-ps1 A ATAGG 9: 39,598,050 (GRCm39) probably null Het
Or6d12 G T 6: 116,493,004 (GRCm39) A89S probably benign Het
Ovol1 A G 19: 5,603,640 (GRCm39) V87A probably benign Het
Pdpk1 T A 17: 24,312,255 (GRCm39) E290D probably benign Het
Pkd1l3 T A 8: 110,350,174 (GRCm39) S340T probably benign Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,820,905 (GRCm39) probably benign Het
Pou3f1 GC GCGGCGCC 4: 124,551,602 (GRCm39) probably benign Het
Prp2 AGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGAGACCCCCTCAAGGCCCACCACC 6: 132,577,475 (GRCm39) probably benign Het
Prpf6 A G 2: 181,273,869 (GRCm39) M338V probably benign Het
Psg28 G T 7: 18,156,847 (GRCm39) L463I probably damaging Het
Ptprd T C 4: 76,046,892 (GRCm39) D211G probably benign Het
Pus1 T C 5: 110,924,424 (GRCm39) H160R not run Het
Ranbp17 T C 11: 33,279,511 (GRCm39) T582A probably damaging Het
Rasa1 G A 13: 85,371,607 (GRCm39) T878I possibly damaging Het
Rbm20 A G 19: 53,802,163 (GRCm39) T224A probably benign Het
Scgb1b12 A T 7: 32,033,920 (GRCm39) N60I probably damaging Het
Sh3bp4 T C 1: 89,072,744 (GRCm39) S531P probably benign Het
Sh3pxd2b TGCCTG TGCCTGCGCCTG 11: 32,373,053 (GRCm39) probably benign Het
Snrnp200 T C 2: 127,072,476 (GRCm39) L1291P probably damaging Het
Spmap2l CTCCCCAGTCCCGCAAGGCCAG CTCCCCAGTCCCGCAAGGCCAGCGATCATCCCCAGTCCCGCAAGGCCAG 5: 77,164,255 (GRCm39) probably benign Het
Sppl2a C T 2: 126,769,694 (GRCm39) R54Q probably benign Het
Sulf2 A T 2: 165,924,523 (GRCm39) L521Q probably benign Het
Supv3l1 C A 10: 62,273,287 (GRCm39) V317F possibly damaging Het
Tcof1 TCC TCCACTTGGCTGCTGAGATGGGCACTTTCCCAGAGACCC 18: 60,966,647 (GRCm39) probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCCGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,673,138 (GRCm39) probably benign Het
Unc13b CAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CAGAGCCAGAGCCAGAGCGAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,347 (GRCm39) probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC AGCCAGAGCCAGAGCCAGCGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,350 (GRCm39) probably benign Het
Usp38 A G 8: 81,740,522 (GRCm39) S182P probably benign Het
Vmn2r24 T C 6: 123,781,174 (GRCm39) V460A probably benign Het
Wdr97 A T 15: 76,240,172 (GRCm39) I331F Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,899,745 (GRCm39) probably benign Het
Other mutations in Gins4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Gins4 APN 8 23,717,343 (GRCm39) missense probably benign 0.38
IGL01824:Gins4 APN 8 23,724,784 (GRCm39) nonsense probably null
IGL02304:Gins4 APN 8 23,722,625 (GRCm39) missense probably benign
IGL03194:Gins4 APN 8 23,724,762 (GRCm39) splice site probably benign
R0058:Gins4 UTSW 8 23,719,526 (GRCm39) splice site probably benign
R0058:Gins4 UTSW 8 23,719,526 (GRCm39) splice site probably benign
R0267:Gins4 UTSW 8 23,719,426 (GRCm39) splice site probably benign
R1428:Gins4 UTSW 8 23,717,144 (GRCm39) missense probably damaging 1.00
R1519:Gins4 UTSW 8 23,724,792 (GRCm39) missense probably benign 0.04
R4691:Gins4 UTSW 8 23,727,075 (GRCm39) missense probably benign 0.40
R4933:Gins4 UTSW 8 23,724,796 (GRCm39) missense probably damaging 0.99
R5088:Gins4 UTSW 8 23,727,084 (GRCm39) missense possibly damaging 0.87
R8098:Gins4 UTSW 8 23,727,037 (GRCm39) missense probably benign
R9679:Gins4 UTSW 8 23,717,132 (GRCm39) missense probably damaging 1.00
RF006:Gins4 UTSW 8 23,717,183 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACGACTGACTCTTTCCACCG -3'
(R):5'- GACTTTGCCAATGCTTATGGTG -3'

Sequencing Primer
(F):5'- CATCAAGCAAGTCAGACCTGGG -3'
(R):5'- ACTTTGCCAATGCTTATGGTGCTTAG -3'
Posted On 2019-12-04