Incidental Mutation 'RF016:Gins4'
Institutional Source Beutler Lab
Gene Symbol Gins4
Ensembl Gene ENSMUSG00000031546
Gene NameGINS complex subunit 4 (Sld5 homolog)
Synonyms2810037C03Rik, SLD5, 4933405K01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF016 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location23226616-23237659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23232610 bp
Amino Acid Change Methionine to Valine at position 98 (M98V)
Ref Sequence ENSEMBL: ENSMUSP00000033950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033950]
AlphaFold Q99LZ3
Predicted Effect probably benign
Transcript: ENSMUST00000033950
AA Change: M98V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033950
Gene: ENSMUSG00000031546
AA Change: M98V

Pfam:Sld5 20 127 5.3e-9 PFAM
Pfam:SLD5_C 165 223 4.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5, Psf1 (GINS1; MIM 610608), Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]). See GINS1 for additional information about the GINS complex.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant animals do not survive past implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGCTGTGGC TGCTGTGGCGGCTGTGGC 1: 82,913,577 probably benign Het
Abi3bp GCCCACGACCC GCCCACGACCCACGACCC 16: 56,627,587 probably null Het
Amer3 A G 1: 34,587,120 I147V probably damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,909 probably benign Het
Ankhd1 GCGGCG GCGGCGACGGCG 18: 36,560,910 probably benign Het
Ankzf1 G A 1: 75,195,833 R259H probably damaging Het
Apol9b T C 15: 77,735,514 V170A probably benign Het
Asb3 A G 11: 31,061,407 I267M possibly damaging Het
Baz2a A G 10: 128,125,316 E1636G probably benign Het
Birc6 G T 17: 74,689,324 V4513F probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Ccdc27 T C 4: 154,036,110 R410G probably benign Het
Cdhr5 A G 7: 141,272,184 V435A possibly damaging Het
Cercam T C 2: 29,869,305 S15P unknown Het
Cntrl T C 2: 35,119,986 V224A probably benign Het
Comtd1 T A 14: 21,848,596 Q56L probably benign Het
Cul9 CCT CCTACT 17: 46,500,863 probably null Het
Cyb5r4 AGGGA AGGGATGGGACAGACCCACTGCCCCGGGA 9: 87,040,444 probably benign Het
Cyld T A 8: 88,705,441 Y22* probably null Het
Dbt T C 3: 116,539,714 Y278H probably damaging Het
Ddb1 A G 19: 10,627,858 H1070R probably damaging Het
Dek G T 13: 47,098,186 S248* probably null Het
Dixdc1 T C 9: 50,693,641 T300A probably benign Het
Dusp8 A T 7: 142,082,852 S334T probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Ehbp1 T C 11: 22,146,646 N306S probably benign Het
Fcer1a T C 1: 173,225,519 I37V possibly damaging Het
Fgfr2 G T 7: 130,177,680 Q639K probably benign Het
Gab3 CTT CTTATT X: 74,999,985 probably null Het
Gm35339 A T 15: 76,355,972 I331F Het
Gm813 T A 16: 58,616,867 N26I probably damaging Het
Gm8369 GTGTGTGT GTGTGTGTTTGTGTGT 19: 11,511,754 probably null Het
Grik1 G A 16: 88,034,186 S232L Het
Gsg1l A G 7: 126,020,622 probably null Het
H13 G A 2: 152,669,669 E30K probably damaging Het
H2-DMb1 A T 17: 34,157,386 S160C probably damaging Het
Jag1 T A 2: 137,096,256 T275S probably benign Het
Klhdc2 T A 12: 69,303,886 I158K probably damaging Het
Krtap28-10 TCCC TCCCGCACCC 1: 83,042,123 probably benign Het
Lrp2 T A 2: 69,509,205 M1121L probably benign Het
M6pr C T 6: 122,315,165 A152V probably damaging Het
Mapkapk5 T C 5: 121,533,316 Y218C probably damaging Het
Mkrn1 C T 6: 39,419,991 V26I Het
Mro CA CAAACTCGGA 18: 73,869,964 probably null Het
Mrpl3 T C 9: 105,075,253 V303A probably benign Het
Nid2 GGCTAACACCGC GGC 14: 19,751,363 probably benign Het
Olfr212 G T 6: 116,516,043 A89S probably benign Het
Olfr964-ps1 A ATAGG 9: 39,686,754 probably null Het
Ovol1 A G 19: 5,553,612 V87A probably benign Het
Pdpk1 T A 17: 24,093,281 E290D probably benign Het
Pkd1l3 T A 8: 109,623,542 S340T probably benign Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,909,609 probably benign Het
Pou3f1 GC GCGGCGCC 4: 124,657,809 probably benign Het
Prpf6 A G 2: 181,632,076 M338V probably benign Het
Psg28 G T 7: 18,422,922 L463I probably damaging Het
Ptprd T C 4: 76,128,655 D211G probably benign Het
Pus1 T C 5: 110,776,558 H160R not run Het
Ranbp17 T C 11: 33,329,511 T582A probably damaging Het
Rasa1 G A 13: 85,223,488 T878I possibly damaging Het
Rbm20 A G 19: 53,813,732 T224A probably benign Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Sh3bp4 T C 1: 89,145,022 S531P probably benign Het
Sh3pxd2b TGCCTG TGCCTGCGCCTG 11: 32,423,053 probably benign Het
Snrnp200 T C 2: 127,230,556 L1291P probably damaging Het
Sppl2a C T 2: 126,927,774 R54Q probably benign Het
Sulf2 A T 2: 166,082,603 L521Q probably benign Het
Supv3l1 C A 10: 62,437,508 V317F possibly damaging Het
Usp38 A G 8: 81,013,893 S182P probably benign Het
Vmn2r24 T C 6: 123,804,215 V460A probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Other mutations in Gins4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Gins4 APN 8 23227327 missense probably benign 0.38
IGL01824:Gins4 APN 8 23234768 nonsense probably null
IGL02304:Gins4 APN 8 23232609 missense probably benign
IGL03194:Gins4 APN 8 23234746 splice site probably benign
R0058:Gins4 UTSW 8 23229510 splice site probably benign
R0058:Gins4 UTSW 8 23229510 splice site probably benign
R0267:Gins4 UTSW 8 23229410 splice site probably benign
R1428:Gins4 UTSW 8 23227128 missense probably damaging 1.00
R1519:Gins4 UTSW 8 23234776 missense probably benign 0.04
R4691:Gins4 UTSW 8 23237059 missense probably benign 0.40
R4933:Gins4 UTSW 8 23234780 missense probably damaging 0.99
R5088:Gins4 UTSW 8 23237068 missense possibly damaging 0.87
R8098:Gins4 UTSW 8 23237021 missense probably benign
RF006:Gins4 UTSW 8 23227167 missense possibly damaging 0.71
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04