Incidental Mutation 'RF016:Cyld'
ID603555
Institutional Source Beutler Lab
Gene Symbol Cyld
Ensembl Gene ENSMUSG00000036712
Gene NameCYLD lysine 63 deubiquitinase
SynonymsCYLD1, C130039D01Rik, 2900009M21Rik, 2010013M14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF016 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location88697028-88751945 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 88705441 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 22 (Y22*)
Ref Sequence ENSEMBL: ENSMUSP00000039834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043526] [ENSMUST00000098519] [ENSMUST00000109626] [ENSMUST00000209206] [ENSMUST00000209532] [ENSMUST00000209559] [ENSMUST00000211554]
Predicted Effect probably null
Transcript: ENSMUST00000043526
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000039834
Gene: ENSMUSG00000036712
AA Change: Y22*

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
low complexity region 397 411 N/A INTRINSIC
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 591 891 1.7e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098519
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000096119
Gene: ENSMUSG00000036712
AA Change: Y22*

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 307 470 6.5e-88 PFAM
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 590 893 2.1e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109626
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000105254
Gene: ENSMUSG00000036712
AA Change: Y22*

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 304 467 2.5e-88 PFAM
CAP_GLY 468 536 2.68e-20 SMART
Pfam:UCH 587 890 2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209206
AA Change: Y22*
Predicted Effect probably null
Transcript: ENSMUST00000209532
AA Change: Y22*
Predicted Effect probably null
Transcript: ENSMUST00000209559
AA Change: Y22*
Predicted Effect probably null
Transcript: ENSMUST00000211554
AA Change: Y22*
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the ubiquitin C-terminal hydrolase subfamily of the deubiquitinating enzyme family. Members of this family catalyze the removal of ubiquitin from a substrate or another ubiquitin molecule and thereby play important roles in regulating signaling pathways, recycling ubiquitin and regulating protein stability. This protein removes ubiquitin from K-63-linked ubiquitin chains from proteins involved in NF-kappaB signaling and thus acts as a negative regulator of this pathway. In humans mutations in this gene have been associated with cylindromatosis, an autosomal dominant predisposition to tumors of skin appendages. In mouse deficiency of this gene impairs thymocyte development and increases susceptibility to skin and colon tumors. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Various knockout models with different exon deletions have been created. Observed phenotypes include altered T cell and B cell development, susceptibility to induced skin tumors, resistance to lethal lung infection, high colon tumor incidence, kinky tails, and neonatal death due to lung dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGCTGTGGC TGCTGTGGCGGCTGTGGC 1: 82,913,577 probably benign Het
Abi3bp GCCCACGACCC GCCCACGACCCACGACCC 16: 56,627,587 probably null Het
Amer3 A G 1: 34,587,120 I147V probably damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,909 probably benign Het
Ankhd1 GCGGCG GCGGCGACGGCG 18: 36,560,910 probably benign Het
Ankzf1 G A 1: 75,195,833 R259H probably damaging Het
Apol9b T C 15: 77,735,514 V170A probably benign Het
Asb3 A G 11: 31,061,407 I267M possibly damaging Het
Baz2a A G 10: 128,125,316 E1636G probably benign Het
Birc6 G T 17: 74,689,324 V4513F probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Ccdc27 T C 4: 154,036,110 R410G probably benign Het
Cdhr5 A G 7: 141,272,184 V435A possibly damaging Het
Cercam T C 2: 29,869,305 S15P unknown Het
Cntrl T C 2: 35,119,986 V224A probably benign Het
Comtd1 T A 14: 21,848,596 Q56L probably benign Het
Cul9 CCT CCTACT 17: 46,500,863 probably null Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGA TGTGACAGACACACTGCCCAGGGACGTGACAGACACACTGCCCAGGGA 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGACAGACACACTGACCAGGGA 9: 87,040,441 probably benign Het
Cyb5r4 AGGGA AGGGATGGGACAGACCCACTGCCCCGGGA 9: 87,040,444 probably benign Het
Dbt T C 3: 116,539,714 Y278H probably damaging Het
Ddb1 A G 19: 10,627,858 H1070R probably damaging Het
Dek G T 13: 47,098,186 S248* probably null Het
Dixdc1 T C 9: 50,693,641 T300A probably benign Het
Dusp8 A T 7: 142,082,852 S334T probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,756 probably benign Het
Ehbp1 T C 11: 22,146,646 N306S probably benign Het
Fcer1a T C 1: 173,225,519 I37V possibly damaging Het
Fgfr2 G T 7: 130,177,680 Q639K probably benign Het
Gab3 CTT CTTATT X: 74,999,985 probably null Het
Gins4 T C 8: 23,232,610 M98V probably benign Het
Gm35339 A T 15: 76,355,972 I331F Het
Gm813 T A 16: 58,616,867 N26I probably damaging Het
Gm8369 GTGTGTGT GTGTGTGTTTGTGTGT 19: 11,511,754 probably null Het
Grik1 G A 16: 88,034,186 S232L Het
Gsg1l A G 7: 126,020,622 probably null Het
H13 G A 2: 152,669,669 E30K probably damaging Het
H2-DMb1 A T 17: 34,157,386 S160C probably damaging Het
Hsdl2 GCAGCCACAGCTGCAG GCAGCCACAGCTGCAGCATCAGCCACAGCTGCAG 4: 59,610,643 probably benign Het
Iqcf4 TTTCCTTTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTGTTCCTTTTCCTTTT 9: 106,570,609 probably benign Het
Jag1 T A 2: 137,096,256 T275S probably benign Het
Klhdc2 T A 12: 69,303,886 I158K probably damaging Het
Krtap28-10 TCCC TCCCGCACCC 1: 83,042,123 probably benign Het
Lrp2 T A 2: 69,509,205 M1121L probably benign Het
M6pr C T 6: 122,315,165 A152V probably damaging Het
Mapkapk5 T C 5: 121,533,316 Y218C probably damaging Het
Mkrn1 C T 6: 39,419,991 V26I Het
Mro CA CAAACTCGGA 18: 73,869,964 probably null Het
Mrpl3 T C 9: 105,075,253 V303A probably benign Het
Nefh CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,022 probably benign Het
Nefh TCACCTGGGGACT TCACCTGGGGACTCGGCCCCACCTGGGGACT 11: 4,941,023 probably benign Het
Nid2 GGCTAACACCGC GGC 14: 19,751,363 probably benign Het
Nusap1 CAAGCTGAGA CAAGCTGAGATACACGTTAGCAGTGAGGAGAAAGCTGAGA 2: 119,627,601 probably benign Het
Olfr212 G T 6: 116,516,043 A89S probably benign Het
Olfr964-ps1 A ATAGG 9: 39,686,754 probably null Het
Ovol1 A G 19: 5,553,612 V87A probably benign Het
Pdpk1 T A 17: 24,093,281 E290D probably benign Het
Pkd1l3 T A 8: 109,623,542 S340T probably benign Het
Pknox2 ACACACACACACACACTCAC ACAC 9: 36,909,609 probably benign Het
Pou3f1 GC GCGGCGCC 4: 124,657,809 probably benign Het
Prp2 AGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGAGACCCCCTCAAGGCCCACCACC 6: 132,600,512 probably benign Het
Prpf6 A G 2: 181,632,076 M338V probably benign Het
Psg28 G T 7: 18,422,922 L463I probably damaging Het
Ptprd T C 4: 76,128,655 D211G probably benign Het
Pus1 T C 5: 110,776,558 H160R not run Het
Ranbp17 T C 11: 33,329,511 T582A probably damaging Het
Rasa1 G A 13: 85,223,488 T878I possibly damaging Het
Rbm20 A G 19: 53,813,732 T224A probably benign Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Sh3bp4 T C 1: 89,145,022 S531P probably benign Het
Sh3pxd2b TGCCTG TGCCTGCGCCTG 11: 32,423,053 probably benign Het
Snrnp200 T C 2: 127,230,556 L1291P probably damaging Het
Sppl2a C T 2: 126,927,774 R54Q probably benign Het
Sulf2 A T 2: 166,082,603 L521Q probably benign Het
Supv3l1 C A 10: 62,437,508 V317F possibly damaging Het
Tcof1 TCC TCCACTTGGCTGCTGAGATGGGCACTTTCCCAGAGACCC 18: 60,833,575 probably benign Het
Thegl CTCCCCAGTCCCGCAAGGCCAG CTCCCCAGTCCCGCAAGGCCAGCGATCATCCCCAGTCCCGCAAGGCCAG 5: 77,016,408 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCCGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,289 probably benign Het
Unc13b CAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CAGAGCCAGAGCCAGAGCGAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,347 probably benign Het
Unc13b AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC AGCCAGAGCCAGAGCCAGCGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,350 probably benign Het
Usp38 A G 8: 81,013,893 S182P probably benign Het
Vmn2r24 T C 6: 123,804,215 V460A probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Other mutations in Cyld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cyld APN 8 88705457 missense probably benign 0.41
IGL00481:Cyld APN 8 88707290 missense probably damaging 1.00
IGL01013:Cyld APN 8 88742362 missense probably damaging 1.00
IGL01653:Cyld APN 8 88741370 missense probably damaging 1.00
IGL01700:Cyld APN 8 88707099 missense probably damaging 0.99
IGL01845:Cyld APN 8 88705775 nonsense probably null
IGL02366:Cyld APN 8 88729753 missense probably damaging 1.00
IGL02379:Cyld APN 8 88744928 nonsense probably null
IGL02506:Cyld APN 8 88729590 missense possibly damaging 0.86
IGL02563:Cyld APN 8 88735894 missense probably damaging 1.00
IGL02565:Cyld APN 8 88741291 missense probably damaging 1.00
IGL02814:Cyld APN 8 88744897 missense probably benign 0.29
PIT4131001:Cyld UTSW 8 88746915 missense probably damaging 0.98
R0101:Cyld UTSW 8 88718300 critical splice donor site probably null
R0122:Cyld UTSW 8 88742292 missense probably damaging 1.00
R0529:Cyld UTSW 8 88729759 missense probably benign 0.34
R0838:Cyld UTSW 8 88741350 missense probably benign 0.15
R1589:Cyld UTSW 8 88709990 missense possibly damaging 0.84
R1732:Cyld UTSW 8 88731667 splice site probably benign
R2029:Cyld UTSW 8 88745312 missense probably benign 0.09
R3701:Cyld UTSW 8 88729551 missense probably benign
R3798:Cyld UTSW 8 88734930 missense probably damaging 1.00
R4243:Cyld UTSW 8 88730755 nonsense probably null
R4244:Cyld UTSW 8 88730755 nonsense probably null
R4260:Cyld UTSW 8 88741391 missense probably damaging 1.00
R4458:Cyld UTSW 8 88719301 missense probably benign 0.24
R4551:Cyld UTSW 8 88707134 missense possibly damaging 0.95
R4718:Cyld UTSW 8 88742305 missense probably damaging 0.99
R4735:Cyld UTSW 8 88729650 missense probably damaging 1.00
R4753:Cyld UTSW 8 88744816 splice site probably null
R4966:Cyld UTSW 8 88742301 missense possibly damaging 0.55
R4975:Cyld UTSW 8 88707232 missense probably benign
R5375:Cyld UTSW 8 88733036 missense possibly damaging 0.77
R5647:Cyld UTSW 8 88734926 missense probably benign 0.10
R5741:Cyld UTSW 8 88744846 missense probably damaging 1.00
R5837:Cyld UTSW 8 88741404 missense probably damaging 0.99
R5931:Cyld UTSW 8 88729842 splice site probably null
R5970:Cyld UTSW 8 88732993 missense probably damaging 0.99
R5992:Cyld UTSW 8 88733053 missense probably damaging 1.00
R6165:Cyld UTSW 8 88746933 missense possibly damaging 0.88
R7135:Cyld UTSW 8 88744892 missense possibly damaging 0.93
R7667:Cyld UTSW 8 88742302 missense probably benign 0.01
R7858:Cyld UTSW 8 88709988 missense probably damaging 0.98
R7912:Cyld UTSW 8 88734897 missense probably damaging 1.00
R7941:Cyld UTSW 8 88709988 missense probably damaging 0.98
R7993:Cyld UTSW 8 88734897 missense probably damaging 1.00
X0010:Cyld UTSW 8 88746912 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCAGGCACTTTGAATTGC -3'
(R):5'- AACAGAACTGCATGCGGTTG -3'

Sequencing Primer
(F):5'- GCCAGGTTGCTAAAATCTTGC -3'
(R):5'- TGCATGCGGTTGCTCCAAG -3'
Posted On2019-12-04