Incidental Mutation 'RF017:Spaca1'
ID 603609
Institutional Source Beutler Lab
Gene Symbol Spaca1
Ensembl Gene ENSMUSG00000028264
Gene Name sperm acrosome associated 1
Synonyms 1700124L11Rik, 4930540L03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF017 (G1)
Quality Score 217.982
Status Not validated
Chromosome 4
Chromosomal Location 34024874-34050191 bp(-) (GRCm38)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) CTCGC to CTCGCTGTCGC at 34049853 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029927] [ENSMUST00000084734]
AlphaFold Q9DA48
Predicted Effect probably benign
Transcript: ENSMUST00000029927
SMART Domains Protein: ENSMUSP00000029927
Gene: ENSMUSG00000028264

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084734
SMART Domains Protein: ENSMUSP00000081785
Gene: ENSMUSG00000028264

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice are infertile and display globozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik AA AACTGTCA 10: 82,290,992 probably benign Het
Ahdc1 ACCACC ACCACCACC 4: 133,062,751 probably benign Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,909 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
AY358078 T TAGGATAATGA 14: 51,805,593 probably null Het
Ccdc170 CCA CCAGCA 10: 4,561,024 probably benign Het
Cntrl C A 2: 35,175,189 D2168E probably damaging Het
Dab1 C A 4: 104,713,652 R195S probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGCGCACAGTTCCTACCTCGTT 9: 20,910,126 probably null Het
Elp6 A T 9: 110,319,709 H222L probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Fam71e1 GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGATCTGAGGGAGGA 7: 44,500,525 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgf22 A G 10: 79,756,846 H125R probably benign Het
Galnt18 G A 7: 111,599,014 R180C probably damaging Het
Gm4969 T C 7: 19,102,429 N291S unknown Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gpsm1 C A 2: 26,324,872 H288Q probably damaging Het
Ipo7 A G 7: 110,048,794 I628V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,138 probably benign Het
Krtap28-10 CCACCACAGCCACAG CCACCACAGCCACAGTCACCACAGCCACAG 1: 83,042,266 probably benign Het
Krtap4-2 CAGCAGGGGCGGCA C 11: 99,634,717 probably null Het
Krtap4-9 TGCTGTGTGTCCAGCTGCTGCAG TGCTGTGTGTCCAGCTGCTGCAGGCCCAGCGGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,399 probably benign Het
Larp4b G T 13: 9,123,910 G30V probably benign Het
Lrmp GCACATTG GCACATTGATCACATTG 6: 145,173,784 probably benign Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGGTCCAGCTCCA 2: 121,306,308 probably benign Het
Mccc2 A C 13: 100,000,288 V53G probably damaging Het
Mug1 T A 6: 121,884,574 Y1332N probably damaging Het
Ndnf A G 6: 65,704,329 T531A probably damaging Het
Ntsr2 T G 12: 16,659,765 V349G probably damaging Het
Olfr117 A T 17: 37,659,781 I184N probably damaging Het
P2ry14 A T 3: 59,115,046 I331N probably benign Het
Pcdha11 T C 18: 37,005,524 S69P possibly damaging Het
Ptp4a2 A G 4: 129,839,444 probably benign Het
Ptpn13 A G 5: 103,593,580 D2353G probably benign Het
Rasa2 GCC GCCCCC 9: 96,631,468 probably benign Het
Raver2 A T 4: 101,102,998 D225V probably damaging Het
Rph3a A T 5: 120,962,499 probably null Het
Sin3a T A 9: 57,127,326 V1261E possibly damaging Het
Slc12a9 T A 5: 137,325,550 I368F probably damaging Het
Strn C CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTG 17: 78,677,288 probably null Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,365 probably benign Het
Ush2a A C 1: 188,263,469 T146P probably damaging Het
Usp37 A G 1: 74,470,690 L440P probably damaging Het
Wdr66 AAGAGGAGGAAGAGGAGGGGGAGAAGGAG AAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,890 probably benign Het
Xpnpep1 T A 19: 53,032,060 I24L probably benign Het
Other mutations in Spaca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spaca1 APN 4 34029077 missense probably damaging 0.99
IGL01871:Spaca1 APN 4 34040894 missense probably damaging 0.98
F5770:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
FR4342:Spaca1 UTSW 4 34049838 small insertion probably benign
FR4548:Spaca1 UTSW 4 34049856 small insertion probably benign
FR4737:Spaca1 UTSW 4 34049836 small insertion probably benign
FR4976:Spaca1 UTSW 4 34049844 small insertion probably benign
FR4976:Spaca1 UTSW 4 34049849 small insertion probably benign
R0377:Spaca1 UTSW 4 34044267 splice site probably null
R1861:Spaca1 UTSW 4 34044206 missense probably damaging 0.99
R3105:Spaca1 UTSW 4 34028468 missense probably damaging 1.00
R4930:Spaca1 UTSW 4 34044236 missense possibly damaging 0.65
R5030:Spaca1 UTSW 4 34039247 missense possibly damaging 0.65
R5137:Spaca1 UTSW 4 34029095 missense probably damaging 1.00
R5264:Spaca1 UTSW 4 34049863 missense possibly damaging 0.53
R6158:Spaca1 UTSW 4 34029176 missense probably damaging 0.99
R6824:Spaca1 UTSW 4 34049869 missense probably benign 0.00
R8039:Spaca1 UTSW 4 34044207 missense probably damaging 0.99
R8094:Spaca1 UTSW 4 34049837 missense possibly damaging 0.55
R8134:Spaca1 UTSW 4 34042157 splice site probably null
R9120:Spaca1 UTSW 4 34029168 missense probably damaging 0.97
RF006:Spaca1 UTSW 4 34049853 small insertion probably benign
RF032:Spaca1 UTSW 4 34049854 small insertion probably benign
RF043:Spaca1 UTSW 4 34049846 small insertion probably benign
RF044:Spaca1 UTSW 4 34049846 small insertion probably benign
RF044:Spaca1 UTSW 4 34049854 small insertion probably benign
RF060:Spaca1 UTSW 4 34049841 small insertion probably benign
V7580:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7581:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7582:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7583:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCAGAAAACTCTACAGAAGATG -3'
(R):5'- ACTGTTCGAAGCAGCCTCTC -3'

Sequencing Primer
(F):5'- AAAAGGATGGGCTTCTGG -3'
(R):5'- GAAGCAGCCTCTCCTCCAG -3'
Posted On 2019-12-04