Incidental Mutation 'RF017:Ccdc170'
ID603629
Institutional Source Beutler Lab
Gene Symbol Ccdc170
Ensembl Gene ENSMUSG00000019767
Gene Namecoiled-coil domain containing 170
SynonymsGm221, LOC237250
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #RF017 (G1)
Quality Score178.468
Status Not validated
Chromosome10
Chromosomal Location4482502-4562231 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CCA to CCAGCA at 4561024 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019901] [ENSMUST00000138112]
Predicted Effect probably benign
Transcript: ENSMUST00000019901
SMART Domains Protein: ENSMUSP00000019901
Gene: ENSMUSG00000019767

DomainStartEndE-ValueType
coiled coil region 40 160 N/A INTRINSIC
coiled coil region 264 302 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
coiled coil region 379 415 N/A INTRINSIC
coiled coil region 475 649 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138112
SMART Domains Protein: ENSMUSP00000115997
Gene: ENSMUSG00000019767

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
internal_repeat_1 80 93 6.25e-5 PROSPERO
internal_repeat_1 305 318 6.25e-5 PROSPERO
low complexity region 351 363 N/A INTRINSIC
coiled coil region 385 421 N/A INTRINSIC
coiled coil region 481 655 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene and its encoded protein is not known. Several genome-wide association studies have implicated the region around this gene to be involved in breast cancer and bone mineral density, but no link to this specific gene has been found. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik AA AACTGTCA 10: 82,290,992 probably benign Het
Ahdc1 ACCACC ACCACCACC 4: 133,062,751 probably benign Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,909 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
AY358078 T TAGGATAATGA 14: 51,805,593 probably null Het
Cntrl C A 2: 35,175,189 D2168E probably damaging Het
Dab1 C A 4: 104,713,652 R195S probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGCGCACAGTTCCTACCTCGTT 9: 20,910,126 probably null Het
Elp6 A T 9: 110,319,709 H222L probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Fam71e1 GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGATCTGAGGGAGGA 7: 44,500,525 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgf22 A G 10: 79,756,846 H125R probably benign Het
Galnt18 G A 7: 111,599,014 R180C probably damaging Het
Gm4969 T C 7: 19,102,429 N291S unknown Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gpsm1 C A 2: 26,324,872 H288Q probably damaging Het
Ipo7 A G 7: 110,048,794 I628V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,138 probably benign Het
Krtap28-10 CCACCACAGCCACAG CCACCACAGCCACAGTCACCACAGCCACAG 1: 83,042,266 probably benign Het
Krtap4-2 CAGCAGGGGCGGCA C 11: 99,634,717 probably null Het
Krtap4-9 TGCTGTGTGTCCAGCTGCTGCAG TGCTGTGTGTCCAGCTGCTGCAGGCCCAGCGGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,399 probably benign Het
Larp4b G T 13: 9,123,910 G30V probably benign Het
Lrmp GCACATTG GCACATTGATCACATTG 6: 145,173,784 probably benign Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGGTCCAGCTCCA 2: 121,306,308 probably benign Het
Mccc2 A C 13: 100,000,288 V53G probably damaging Het
Mug1 T A 6: 121,884,574 Y1332N probably damaging Het
Ndnf A G 6: 65,704,329 T531A probably damaging Het
Ntsr2 T G 12: 16,659,765 V349G probably damaging Het
Olfr117 A T 17: 37,659,781 I184N probably damaging Het
P2ry14 A T 3: 59,115,046 I331N probably benign Het
Pcdha11 T C 18: 37,005,524 S69P possibly damaging Het
Ptp4a2 A G 4: 129,839,444 probably benign Het
Ptpn13 A G 5: 103,593,580 D2353G probably benign Het
Rasa2 GCC GCCCCC 9: 96,631,468 probably benign Het
Raver2 A T 4: 101,102,998 D225V probably damaging Het
Rph3a A T 5: 120,962,499 probably null Het
Sin3a T A 9: 57,127,326 V1261E possibly damaging Het
Slc12a9 T A 5: 137,325,550 I368F probably damaging Het
Spaca1 CTCGC CTCGCTGTCGC 4: 34,049,853 probably benign Het
Strn C CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTG 17: 78,677,288 probably null Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,365 probably benign Het
Ush2a A C 1: 188,263,469 T146P probably damaging Het
Usp37 A G 1: 74,470,690 L440P probably damaging Het
Wdr66 AAGAGGAGGAAGAGGAGGGGGAGAAGGAG AAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,890 probably benign Het
Xpnpep1 T A 19: 53,032,060 I24L probably benign Het
Other mutations in Ccdc170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc170 APN 10 4546836 missense probably damaging 1.00
IGL01018:Ccdc170 APN 10 4512788 missense probably benign
IGL01018:Ccdc170 APN 10 4514155 missense probably benign 0.00
IGL01018:Ccdc170 APN 10 4514114 missense probably benign
IGL01114:Ccdc170 APN 10 4558550 missense probably benign 0.01
IGL01377:Ccdc170 APN 10 4560966 missense probably damaging 1.00
IGL01726:Ccdc170 APN 10 4549713 missense probably benign 0.04
IGL02110:Ccdc170 APN 10 4541885 splice site probably null
FR4304:Ccdc170 UTSW 10 4561021 small insertion probably benign
FR4548:Ccdc170 UTSW 10 4561026 small insertion probably benign
FR4737:Ccdc170 UTSW 10 4561023 small insertion probably benign
FR4737:Ccdc170 UTSW 10 4561029 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561008 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561023 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561029 small insertion probably benign
R0137:Ccdc170 UTSW 10 4546950 splice site probably benign
R0280:Ccdc170 UTSW 10 4558663 missense possibly damaging 0.62
R0480:Ccdc170 UTSW 10 4518939 missense probably benign 0.00
R1786:Ccdc170 UTSW 10 4519043 missense probably benign 0.02
R2383:Ccdc170 UTSW 10 4534208 missense probably benign 0.00
R3031:Ccdc170 UTSW 10 4518931 missense probably damaging 0.99
R3797:Ccdc170 UTSW 10 4560920 missense possibly damaging 0.60
R4494:Ccdc170 UTSW 10 4514128 missense probably damaging 1.00
R4916:Ccdc170 UTSW 10 4518971 missense probably damaging 0.96
R5152:Ccdc170 UTSW 10 4561107 missense probably damaging 1.00
R5170:Ccdc170 UTSW 10 4514200 missense probably damaging 0.99
R5354:Ccdc170 UTSW 10 4534188 missense probably benign 0.16
R5911:Ccdc170 UTSW 10 4558551 nonsense probably null
R5983:Ccdc170 UTSW 10 4520851 nonsense probably null
R6374:Ccdc170 UTSW 10 4549746 nonsense probably null
R6645:Ccdc170 UTSW 10 4560974 missense possibly damaging 0.95
R6818:Ccdc170 UTSW 10 4541782 missense probably damaging 1.00
R6888:Ccdc170 UTSW 10 4546854 missense possibly damaging 0.91
R7032:Ccdc170 UTSW 10 4482597 missense unknown
R7206:Ccdc170 UTSW 10 4514120 missense possibly damaging 0.66
R7393:Ccdc170 UTSW 10 4514314 critical splice donor site probably null
R7438:Ccdc170 UTSW 10 4558512 nonsense probably null
R7471:Ccdc170 UTSW 10 4520803 missense probably benign 0.00
R7514:Ccdc170 UTSW 10 4546839 missense probably benign 0.37
R7818:Ccdc170 UTSW 10 4549603 missense probably benign 0.05
RF006:Ccdc170 UTSW 10 4561030 small insertion probably benign
RF009:Ccdc170 UTSW 10 4561030 small insertion probably benign
RF011:Ccdc170 UTSW 10 4561018 small insertion probably benign
RF023:Ccdc170 UTSW 10 4561018 small insertion probably benign
RF024:Ccdc170 UTSW 10 4561024 small insertion probably benign
RF025:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF027:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF029:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF050:Ccdc170 UTSW 10 4561008 small insertion probably benign
RF064:Ccdc170 UTSW 10 4561025 small insertion probably benign
Z1177:Ccdc170 UTSW 10 4509884 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTATTGTTGTTGCACTTGACCCAG -3'
(R):5'- GTCACACACTATGGCTGAATTTC -3'

Sequencing Primer
(F):5'- GTTGCACTTGACCCAGCAATG -3'
(R):5'- CACAACTGGAGAATCGTAC -3'
Posted On2019-12-04