Incidental Mutation 'RF017:Krtap4-9'
ID603634
Institutional Source Beutler Lab
Gene Symbol Krtap4-9
Ensembl Gene ENSMUSG00000078262
Gene Namekeratin associated protein 4-9
SynonymsOTTMUSG00000002198
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #RF017 (G1)
Quality Score104.467
Status Not validated
Chromosome11
Chromosomal Location99785200-99786258 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TGCTGTGTGTCCAGCTGCTGCAG to TGCTGTGTGTCCAGCTGCTGCAGGCCCAGCGGCTGTGTGTCCAGCTGCTGCAG at 99785399 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105059] [ENSMUST00000107439]
Predicted Effect probably benign
Transcript: ENSMUST00000105059
SMART Domains Protein: ENSMUSP00000100680
Gene: ENSMUSG00000078262

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 1.2e-8 PFAM
Pfam:Keratin_B2_2 14 58 4.4e-13 PFAM
Pfam:Keratin_B2_2 54 102 3e-10 PFAM
Pfam:Keratin_B2_2 87 132 8.4e-12 PFAM
Pfam:Keratin_B2_2 98 147 3.4e-9 PFAM
Pfam:Keratin_B2_2 138 182 3.1e-12 PFAM
Pfam:Keratin_B2_2 178 222 4.8e-12 PFAM
Pfam:Keratin_B2_2 203 244 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107439
SMART Domains Protein: ENSMUSP00000103063
Gene: ENSMUSG00000089724

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 14 58 1.8e-13 PFAM
Pfam:Keratin_B2_2 54 98 6.7e-15 PFAM
Pfam:Keratin_B2_2 94 138 9.5e-15 PFAM
Pfam:Keratin_B2_2 138 182 1.5e-12 PFAM
Pfam:Keratin_B2_2 168 209 8.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik AA AACTGTCA 10: 82,290,992 probably benign Het
Ahdc1 ACCACC ACCACCACC 4: 133,062,751 probably benign Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,909 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
AY358078 T TAGGATAATGA 14: 51,805,593 probably null Het
Ccdc170 CCA CCAGCA 10: 4,561,024 probably benign Het
Cntrl C A 2: 35,175,189 D2168E probably damaging Het
Dab1 C A 4: 104,713,652 R195S probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGCGCACAGTTCCTACCTCGTT 9: 20,910,126 probably null Het
Elp6 A T 9: 110,319,709 H222L probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Fam71e1 GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGATCTGAGGGAGGA 7: 44,500,525 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgf22 A G 10: 79,756,846 H125R probably benign Het
Galnt18 G A 7: 111,599,014 R180C probably damaging Het
Gm4969 T C 7: 19,102,429 N291S unknown Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gpsm1 C A 2: 26,324,872 H288Q probably damaging Het
Ipo7 A G 7: 110,048,794 I628V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,138 probably benign Het
Krtap28-10 CCACCACAGCCACAG CCACCACAGCCACAGTCACCACAGCCACAG 1: 83,042,266 probably benign Het
Krtap4-2 CAGCAGGGGCGGCA C 11: 99,634,717 probably null Het
Larp4b G T 13: 9,123,910 G30V probably benign Het
Lrmp GCACATTG GCACATTGATCACATTG 6: 145,173,784 probably benign Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGGTCCAGCTCCA 2: 121,306,308 probably benign Het
Mccc2 A C 13: 100,000,288 V53G probably damaging Het
Mug1 T A 6: 121,884,574 Y1332N probably damaging Het
Ndnf A G 6: 65,704,329 T531A probably damaging Het
Ntsr2 T G 12: 16,659,765 V349G probably damaging Het
Olfr117 A T 17: 37,659,781 I184N probably damaging Het
P2ry14 A T 3: 59,115,046 I331N probably benign Het
Pcdha11 T C 18: 37,005,524 S69P possibly damaging Het
Ptp4a2 A G 4: 129,839,444 probably benign Het
Ptpn13 A G 5: 103,593,580 D2353G probably benign Het
Rasa2 GCC GCCCCC 9: 96,631,468 probably benign Het
Raver2 A T 4: 101,102,998 D225V probably damaging Het
Rph3a A T 5: 120,962,499 probably null Het
Sin3a T A 9: 57,127,326 V1261E possibly damaging Het
Slc12a9 T A 5: 137,325,550 I368F probably damaging Het
Spaca1 CTCGC CTCGCTGTCGC 4: 34,049,853 probably benign Het
Strn C CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTG 17: 78,677,288 probably null Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,365 probably benign Het
Ush2a A C 1: 188,263,469 T146P probably damaging Het
Usp37 A G 1: 74,470,690 L440P probably damaging Het
Wdr66 AAGAGGAGGAAGAGGAGGGGGAGAAGGAG AAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,890 probably benign Het
Xpnpep1 T A 19: 53,032,060 I24L probably benign Het
Other mutations in Krtap4-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01949:Krtap4-9 APN 11 99785565 unclassified probably benign
IGL02697:Krtap4-9 APN 11 99785748 missense unknown
IGL03176:Krtap4-9 APN 11 99785280 unclassified probably benign
R0988:Krtap4-9 UTSW 11 99785536 nonsense probably null
R1773:Krtap4-9 UTSW 11 99785570 unclassified probably benign
R1838:Krtap4-9 UTSW 11 99785396 unclassified probably benign
R2566:Krtap4-9 UTSW 11 99785666 unclassified probably benign
R2888:Krtap4-9 UTSW 11 99785419 nonsense probably null
R3757:Krtap4-9 UTSW 11 99785618 unclassified probably benign
R4633:Krtap4-9 UTSW 11 99785554 unclassified probably benign
R5930:Krtap4-9 UTSW 11 99785636 unclassified probably benign
R6092:Krtap4-9 UTSW 11 99785655 unclassified probably benign
R6501:Krtap4-9 UTSW 11 99785429 unclassified probably benign
R6934:Krtap4-9 UTSW 11 99785882 nonsense probably null
R7131:Krtap4-9 UTSW 11 99785457 missense unknown
RF023:Krtap4-9 UTSW 11 99785391 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTGCATGTGAGGACAACAGC -3'
(R):5'- GCAGCAGCTGGAAATGCAAC -3'

Sequencing Primer
(F):5'- TGTGAGGACAACAGCCCCTC -3'
(R):5'- TGGCAGCACACAGACTG -3'
Posted On2019-12-04