Incidental Mutation 'RF017:Larp4b'
ID603636
Institutional Source Beutler Lab
Gene Symbol Larp4b
Ensembl Gene ENSMUSG00000033499
Gene NameLa ribonucleoprotein domain family, member 4B
SynonymsLarp5, D13Wsu64e
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #RF017 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location9093881-9174451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 9123910 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 30 (G30V)
Ref Sequence ENSEMBL: ENSMUSP00000140993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091829] [ENSMUST00000188211] [ENSMUST00000188939] [ENSMUST00000190041]
Predicted Effect probably benign
Transcript: ENSMUST00000091829
AA Change: G30V

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000089437
Gene: ENSMUSG00000033499
AA Change: G30V

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188211
AA Change: G30V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140993
Gene: ENSMUSG00000033499
AA Change: G30V

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188939
AA Change: G30V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139578
Gene: ENSMUSG00000033499
AA Change: G30V

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190041
AA Change: G30V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an evolutionarily conserved protein family implicated in RNA metabolism and translation. Members of this family are characterized by the presence of an La motif, which is often located adjacent to one or more RNA recognition motifs (RRM). Together, the two motifs constitute the functional region of the protein and enable its interaction with the RNA substrate. This protein family is divided into five sub-families: the genuine La proteins and four La-related protein (LARP) sub-families. The protein encoded by this gene belongs to LARP sub-family 4. It is a cytoplasmic protein that may play a stimulatory role in translation. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik AA AACTGTCA 10: 82,290,992 probably benign Het
Ahdc1 ACCACC ACCACCACC 4: 133,062,751 probably benign Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,909 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
AY358078 T TAGGATAATGA 14: 51,805,593 probably null Het
Ccdc170 CCA CCAGCA 10: 4,561,024 probably benign Het
Cntrl C A 2: 35,175,189 D2168E probably damaging Het
Dab1 C A 4: 104,713,652 R195S probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGCGCACAGTTCCTACCTCGTT 9: 20,910,126 probably null Het
Elp6 A T 9: 110,319,709 H222L probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Fam71e1 GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGATCTGAGGGAGGA 7: 44,500,525 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgf22 A G 10: 79,756,846 H125R probably benign Het
Galnt18 G A 7: 111,599,014 R180C probably damaging Het
Gm4969 T C 7: 19,102,429 N291S unknown Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gpsm1 C A 2: 26,324,872 H288Q probably damaging Het
Ipo7 A G 7: 110,048,794 I628V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,138 probably benign Het
Krtap28-10 CCACCACAGCCACAG CCACCACAGCCACAGTCACCACAGCCACAG 1: 83,042,266 probably benign Het
Krtap4-2 CAGCAGGGGCGGCA C 11: 99,634,717 probably null Het
Krtap4-9 TGCTGTGTGTCCAGCTGCTGCAG TGCTGTGTGTCCAGCTGCTGCAGGCCCAGCGGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,399 probably benign Het
Lrmp GCACATTG GCACATTGATCACATTG 6: 145,173,784 probably benign Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGGTCCAGCTCCA 2: 121,306,308 probably benign Het
Mccc2 A C 13: 100,000,288 V53G probably damaging Het
Mug1 T A 6: 121,884,574 Y1332N probably damaging Het
Ndnf A G 6: 65,704,329 T531A probably damaging Het
Ntsr2 T G 12: 16,659,765 V349G probably damaging Het
Olfr117 A T 17: 37,659,781 I184N probably damaging Het
P2ry14 A T 3: 59,115,046 I331N probably benign Het
Pcdha11 T C 18: 37,005,524 S69P possibly damaging Het
Ptp4a2 A G 4: 129,839,444 probably benign Het
Ptpn13 A G 5: 103,593,580 D2353G probably benign Het
Rasa2 GCC GCCCCC 9: 96,631,468 probably benign Het
Raver2 A T 4: 101,102,998 D225V probably damaging Het
Rph3a A T 5: 120,962,499 probably null Het
Sin3a T A 9: 57,127,326 V1261E possibly damaging Het
Slc12a9 T A 5: 137,325,550 I368F probably damaging Het
Spaca1 CTCGC CTCGCTGTCGC 4: 34,049,853 probably benign Het
Strn C CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTG 17: 78,677,288 probably null Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,365 probably benign Het
Ush2a A C 1: 188,263,469 T146P probably damaging Het
Usp37 A G 1: 74,470,690 L440P probably damaging Het
Wdr66 AAGAGGAGGAAGAGGAGGGGGAGAAGGAG AAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,890 probably benign Het
Xpnpep1 T A 19: 53,032,060 I24L probably benign Het
Other mutations in Larp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Larp4b APN 13 9158124 missense probably damaging 0.99
IGL02519:Larp4b APN 13 9158580 missense probably benign 0.04
IGL02609:Larp4b APN 13 9170680 missense probably damaging 1.00
R0116:Larp4b UTSW 13 9170688 missense probably damaging 1.00
R0390:Larp4b UTSW 13 9158107 intron probably null
R0585:Larp4b UTSW 13 9147493 missense probably damaging 1.00
R0585:Larp4b UTSW 13 9170701 missense probably benign 0.08
R0751:Larp4b UTSW 13 9166309 splice site probably benign
R1184:Larp4b UTSW 13 9166309 splice site probably benign
R1202:Larp4b UTSW 13 9166326 missense possibly damaging 0.84
R1525:Larp4b UTSW 13 9145450 missense probably damaging 1.00
R1599:Larp4b UTSW 13 9122150 missense probably damaging 1.00
R1637:Larp4b UTSW 13 9151097 missense probably benign 0.12
R1833:Larp4b UTSW 13 9151199 missense possibly damaging 0.89
R1852:Larp4b UTSW 13 9137303 critical splice donor site probably null
R1962:Larp4b UTSW 13 9136842 missense probably benign
R2359:Larp4b UTSW 13 9158163 missense probably damaging 0.97
R2973:Larp4b UTSW 13 9166311 splice site probably benign
R3803:Larp4b UTSW 13 9158554 missense probably benign 0.03
R4810:Larp4b UTSW 13 9158591 missense probably benign
R4828:Larp4b UTSW 13 9170898 missense probably damaging 1.00
R5135:Larp4b UTSW 13 9170737 missense probably damaging 1.00
R5250:Larp4b UTSW 13 9170977 utr 3 prime probably benign
R5259:Larp4b UTSW 13 9158184 missense probably damaging 0.98
R5379:Larp4b UTSW 13 9136909 missense probably benign 0.17
R5436:Larp4b UTSW 13 9168900 missense possibly damaging 0.93
R5616:Larp4b UTSW 13 9158659 missense probably damaging 0.98
R5774:Larp4b UTSW 13 9170643 splice site probably null
R5818:Larp4b UTSW 13 9158560 missense probably benign
R6007:Larp4b UTSW 13 9168757 missense probably benign 0.13
R6248:Larp4b UTSW 13 9158702 missense probably benign 0.01
R6452:Larp4b UTSW 13 9147467 missense probably damaging 0.98
R6501:Larp4b UTSW 13 9168793 missense probably damaging 1.00
R7324:Larp4b UTSW 13 9158580 missense probably benign 0.04
R7689:Larp4b UTSW 13 9136798 missense probably damaging 1.00
R7737:Larp4b UTSW 13 9170643 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGTGCCACTGTACTTCTGGATATC -3'
(R):5'- ACTACTATGTCTGACACACTGTG -3'

Sequencing Primer
(F):5'- CCCAGTGGGTTTGGTTTTACTTA -3'
(R):5'- TGAACATTTAGCACACTCAGGG -3'
Posted On2019-12-04