Incidental Mutation 'RF017:AY358078'
ID603638
Institutional Source Beutler Lab
Gene Symbol AY358078
Ensembl Gene ENSMUSG00000050961
Gene NamecDNA sequence AY358078
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #RF017 (G1)
Quality Score133.915
Status Not validated
Chromosome14
Chromosomal Location51800046-51826359 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to TAGGATAATGA at 51805593 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053821]
Predicted Effect probably null
Transcript: ENSMUST00000053821
SMART Domains Protein: ENSMUSP00000078129
Gene: ENSMUSG00000050961

DomainStartEndE-ValueType
Pfam:Takusan 91 171 5.5e-26 PFAM
coiled coil region 187 220 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik AA AACTGTCA 10: 82,290,992 probably benign Het
Ahdc1 ACCACC ACCACCACC 4: 133,062,751 probably benign Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,909 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Ccdc170 CCA CCAGCA 10: 4,561,024 probably benign Het
Cntrl C A 2: 35,175,189 D2168E probably damaging Het
Dab1 C A 4: 104,713,652 R195S probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGCGCACAGTTCCTACCTCGTT 9: 20,910,126 probably null Het
Elp6 A T 9: 110,319,709 H222L probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Fam71e1 GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGATCTGAGGGAGGA 7: 44,500,525 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgf22 A G 10: 79,756,846 H125R probably benign Het
Galnt18 G A 7: 111,599,014 R180C probably damaging Het
Gm4969 T C 7: 19,102,429 N291S unknown Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gpsm1 C A 2: 26,324,872 H288Q probably damaging Het
Ipo7 A G 7: 110,048,794 I628V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,138 probably benign Het
Krtap28-10 CCACCACAGCCACAG CCACCACAGCCACAGTCACCACAGCCACAG 1: 83,042,266 probably benign Het
Krtap4-2 CAGCAGGGGCGGCA C 11: 99,634,717 probably null Het
Krtap4-9 TGCTGTGTGTCCAGCTGCTGCAG TGCTGTGTGTCCAGCTGCTGCAGGCCCAGCGGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,399 probably benign Het
Larp4b G T 13: 9,123,910 G30V probably benign Het
Lrmp GCACATTG GCACATTGATCACATTG 6: 145,173,784 probably benign Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGGTCCAGCTCCA 2: 121,306,308 probably benign Het
Mccc2 A C 13: 100,000,288 V53G probably damaging Het
Mug1 T A 6: 121,884,574 Y1332N probably damaging Het
Ndnf A G 6: 65,704,329 T531A probably damaging Het
Ntsr2 T G 12: 16,659,765 V349G probably damaging Het
Olfr117 A T 17: 37,659,781 I184N probably damaging Het
P2ry14 A T 3: 59,115,046 I331N probably benign Het
Pcdha11 T C 18: 37,005,524 S69P possibly damaging Het
Ptp4a2 A G 4: 129,839,444 probably benign Het
Ptpn13 A G 5: 103,593,580 D2353G probably benign Het
Rasa2 GCC GCCCCC 9: 96,631,468 probably benign Het
Raver2 A T 4: 101,102,998 D225V probably damaging Het
Sin3a T A 9: 57,127,326 V1261E possibly damaging Het
Slc12a9 T A 5: 137,325,550 I368F probably damaging Het
Spaca1 CTCGC CTCGCTGTCGC 4: 34,049,853 probably benign Het
Strn C CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTG 17: 78,677,288 probably null Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,365 probably benign Het
Ush2a A C 1: 188,263,469 T146P probably damaging Het
Usp37 A G 1: 74,470,690 L440P probably damaging Het
Wdr66 AAGAGGAGGAAGAGGAGGGGGAGAAGGAG AAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,890 probably benign Het
Xpnpep1 T A 19: 53,032,060 I24L probably benign Het
Other mutations in AY358078
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:AY358078 APN 14 51805709 splice site probably benign
IGL02053:AY358078 APN 14 51805552 missense unknown
IGL02057:AY358078 APN 14 51820305 missense unknown
IGL02498:AY358078 APN 14 51803487 missense probably benign 0.00
FR4737:AY358078 UTSW 14 51805698 missense unknown
R0140:AY358078 UTSW 14 51825942 missense probably benign 0.12
R0466:AY358078 UTSW 14 51805632 missense unknown
R0496:AY358078 UTSW 14 51803532 missense unknown
R1546:AY358078 UTSW 14 51820419 intron probably null
R1793:AY358078 UTSW 14 51804594 missense unknown
R1867:AY358078 UTSW 14 51800047 start codon destroyed probably null 0.01
R1993:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R1994:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R1995:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R2184:AY358078 UTSW 14 51825988 missense probably damaging 1.00
R2322:AY358078 UTSW 14 51804690 missense unknown
R2441:AY358078 UTSW 14 51800089 missense probably benign 0.00
R3851:AY358078 UTSW 14 51805553 missense unknown
R3852:AY358078 UTSW 14 51805553 missense unknown
R4600:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4603:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4610:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4611:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4916:AY358078 UTSW 14 51802651 missense unknown
R5096:AY358078 UTSW 14 51826118 missense probably benign 0.19
R5143:AY358078 UTSW 14 51802549 missense unknown
R5609:AY358078 UTSW 14 51804608 missense unknown
R5651:AY358078 UTSW 14 51822160 missense unknown
R6345:AY358078 UTSW 14 51826292 missense probably damaging 1.00
R6988:AY358078 UTSW 14 51826187 missense probably damaging 0.99
R7340:AY358078 UTSW 14 51826259 missense probably damaging 1.00
RF002:AY358078 UTSW 14 51805593 nonsense probably null
RF025:AY358078 UTSW 14 51805589 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAAGCTAGCTGGGAATCAC -3'
(R):5'- GTCAATGCCAATGACTCTGAC -3'

Sequencing Primer
(F):5'- TGTGGTTCAGCATCAGGC -3'
(R):5'- AGATACCTACAGGCTCTGCTG -3'
Posted On2019-12-04