Incidental Mutation 'RF017:Olfr117'
ID603639
Institutional Source Beutler Lab
Gene Symbol Olfr117
Ensembl Gene ENSMUSG00000095286
Gene Nameolfactory receptor 117
SynonymsGA_x6K02T2PSCP-2119438-2118485, MOR256-33
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #RF017 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37657600-37663782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37659781 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 184 (I184N)
Ref Sequence ENSEMBL: ENSMUSP00000150204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073636] [ENSMUST00000213638] [ENSMUST00000215414]
Predicted Effect probably damaging
Transcript: ENSMUST00000073636
AA Change: I184N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073320
Gene: ENSMUSG00000095286
AA Change: I184N

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 222 2e-5 PFAM
Pfam:7tm_1 40 289 2.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213638
AA Change: I184N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215414
AA Change: I184N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik AA AACTGTCA 10: 82,290,992 probably benign Het
Ahdc1 ACCACC ACCACCACC 4: 133,062,751 probably benign Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,909 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
AY358078 T TAGGATAATGA 14: 51,805,593 probably null Het
Ccdc170 CCA CCAGCA 10: 4,561,024 probably benign Het
Cntrl C A 2: 35,175,189 D2168E probably damaging Het
Dab1 C A 4: 104,713,652 R195S probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGCGCACAGTTCCTACCTCGTT 9: 20,910,126 probably null Het
Elp6 A T 9: 110,319,709 H222L probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Fam71e1 GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGATCTGAGGGAGGA 7: 44,500,525 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgf22 A G 10: 79,756,846 H125R probably benign Het
Galnt18 G A 7: 111,599,014 R180C probably damaging Het
Gm4969 T C 7: 19,102,429 N291S unknown Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gpsm1 C A 2: 26,324,872 H288Q probably damaging Het
Ipo7 A G 7: 110,048,794 I628V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,138 probably benign Het
Krtap28-10 CCACCACAGCCACAG CCACCACAGCCACAGTCACCACAGCCACAG 1: 83,042,266 probably benign Het
Krtap4-2 CAGCAGGGGCGGCA C 11: 99,634,717 probably null Het
Krtap4-9 TGCTGTGTGTCCAGCTGCTGCAG TGCTGTGTGTCCAGCTGCTGCAGGCCCAGCGGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,399 probably benign Het
Larp4b G T 13: 9,123,910 G30V probably benign Het
Lrmp GCACATTG GCACATTGATCACATTG 6: 145,173,784 probably benign Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGGTCCAGCTCCA 2: 121,306,308 probably benign Het
Mccc2 A C 13: 100,000,288 V53G probably damaging Het
Mug1 T A 6: 121,884,574 Y1332N probably damaging Het
Ndnf A G 6: 65,704,329 T531A probably damaging Het
Ntsr2 T G 12: 16,659,765 V349G probably damaging Het
P2ry14 A T 3: 59,115,046 I331N probably benign Het
Pcdha11 T C 18: 37,005,524 S69P possibly damaging Het
Ptp4a2 A G 4: 129,839,444 probably benign Het
Ptpn13 A G 5: 103,593,580 D2353G probably benign Het
Rasa2 GCC GCCCCC 9: 96,631,468 probably benign Het
Raver2 A T 4: 101,102,998 D225V probably damaging Het
Rph3a A T 5: 120,962,499 probably null Het
Sin3a T A 9: 57,127,326 V1261E possibly damaging Het
Slc12a9 T A 5: 137,325,550 I368F probably damaging Het
Spaca1 CTCGC CTCGCTGTCGC 4: 34,049,853 probably benign Het
Strn C CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTG 17: 78,677,288 probably null Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,365 probably benign Het
Ush2a A C 1: 188,263,469 T146P probably damaging Het
Usp37 A G 1: 74,470,690 L440P probably damaging Het
Wdr66 AAGAGGAGGAAGAGGAGGGGGAGAAGGAG AAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,890 probably benign Het
Xpnpep1 T A 19: 53,032,060 I24L probably benign Het
Other mutations in Olfr117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Olfr117 APN 17 37659477 missense probably damaging 1.00
IGL01949:Olfr117 APN 17 37659466 missense probably damaging 1.00
IGL02085:Olfr117 APN 17 37659688 missense probably benign 0.11
IGL02481:Olfr117 APN 17 37659472 missense probably damaging 1.00
IGL02483:Olfr117 APN 17 37659472 missense probably damaging 1.00
IGL03274:Olfr117 APN 17 37659755 missense probably benign 0.35
R0234:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R0234:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R1522:Olfr117 UTSW 17 37659770 missense probably damaging 1.00
R1712:Olfr117 UTSW 17 37659908 missense probably benign 0.42
R1750:Olfr117 UTSW 17 37659673 missense probably damaging 1.00
R1865:Olfr117 UTSW 17 37659863 missense possibly damaging 0.78
R2371:Olfr117 UTSW 17 37660153 missense probably damaging 1.00
R2382:Olfr117 UTSW 17 37659931 missense probably benign 0.00
R3798:Olfr117 UTSW 17 37660106 missense probably damaging 0.99
R4831:Olfr117 UTSW 17 37660078 missense probably benign 0.03
R5087:Olfr117 UTSW 17 37659721 missense probably damaging 0.97
R5365:Olfr117 UTSW 17 37659695 missense probably damaging 1.00
R5812:Olfr117 UTSW 17 37659739 missense probably damaging 1.00
R5822:Olfr117 UTSW 17 37660231 missense probably damaging 1.00
R6405:Olfr117 UTSW 17 37660123 missense possibly damaging 0.58
R6945:Olfr117 UTSW 17 37659514 missense possibly damaging 0.95
R7121:Olfr117 UTSW 17 37659808 missense probably damaging 0.98
R7312:Olfr117 UTSW 17 37659512 missense possibly damaging 0.78
R7502:Olfr117 UTSW 17 37660231 missense probably damaging 1.00
R8116:Olfr117 UTSW 17 37659740 missense probably damaging 1.00
R8425:Olfr117 UTSW 17 37660084 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAGGTTCCAAGAGCTTTAC -3'
(R):5'- CACTGAATGTGTCCTCCTCG -3'

Sequencing Primer
(F):5'- AGAGCTTTACCCCAGGTTAGAGC -3'
(R):5'- ATGGCATTTGACCGCTATGC -3'
Posted On2019-12-04