Incidental Mutation 'RF017:Xpnpep1'
ID 603644
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene Name X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms D230045I08Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF017 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 52919710-53027093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53020491 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 24 (I24L)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182097] [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
AlphaFold Q6P1B1
Predicted Effect probably benign
Transcript: ENSMUST00000182097
SMART Domains Protein: ENSMUSP00000138473
Gene: ENSMUSG00000025027

DomainStartEndE-ValueType
Pfam:Creatinase_N 9 119 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect probably benign
Transcript: ENSMUST00000183108
AA Change: I24L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: I24L

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183274
AA Change: I24L

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: I24L

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 ACCACC ACCACCACC 4: 132,790,062 (GRCm39) probably benign Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,693,962 (GRCm39) probably benign Het
Anks1b G A 10: 89,869,087 (GRCm39) G49D probably damaging Het
AY358078 T TAGGATAATGA 14: 52,043,050 (GRCm39) probably null Het
Ccdc170 CCA CCAGCA 10: 4,511,024 (GRCm39) probably benign Het
Cfap251 AAGAGGAGGAAGAGGAGGGGGAGAAGGAG AAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,391,953 (GRCm39) probably benign Het
Cntrl C A 2: 35,065,201 (GRCm39) D2168E probably damaging Het
Dab1 C A 4: 104,570,849 (GRCm39) R195S probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGCGCACAGTTCCTACCTCGTT 9: 20,821,422 (GRCm39) probably null Het
Elp6 A T 9: 110,148,777 (GRCm39) H222L probably damaging Het
Entpd2 CTT CTTT 2: 25,290,907 (GRCm39) probably null Het
Fgf22 A G 10: 79,592,680 (GRCm39) H125R probably benign Het
Galnt18 G A 7: 111,198,221 (GRCm39) R180C probably damaging Het
Garin5a GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGATCTGAGGGAGGA 7: 44,149,949 (GRCm39) probably null Het
Garin5a GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,149,955 (GRCm39) probably null Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,489,106 (GRCm39) probably null Het
Gpsm1 C A 2: 26,214,884 (GRCm39) H288Q probably damaging Het
Ipo7 A G 7: 109,648,001 (GRCm39) I628V probably benign Het
Irag2 GCACATTG GCACATTGATCACATTG 6: 145,119,510 (GRCm39) probably benign Het
Itpkb C T 1: 180,160,887 (GRCm39) R338W probably damaging Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,019,859 (GRCm39) probably benign Het
Krtap28-10 CCACCACAGCCACAG CCACCACAGCCACAGTCACCACAGCCACAG 1: 83,019,987 (GRCm39) probably benign Het
Krtap4-2 CAGCAGGGGCGGCA C 11: 99,525,543 (GRCm39) probably null Het
Krtap4-9 TGCTGTGTGTCCAGCTGCTGCAG TGCTGTGTGTCCAGCTGCTGCAGGCCCAGCGGCTGTGTGTCCAGCTGCTGCAG 11: 99,676,225 (GRCm39) probably benign Het
Larp4b G T 13: 9,173,946 (GRCm39) G30V probably benign Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGGTCCAGCTCCA 2: 121,136,789 (GRCm39) probably benign Het
Mccc2 A C 13: 100,136,796 (GRCm39) V53G probably damaging Het
Meiosin T C 7: 18,836,354 (GRCm39) N291S unknown Het
Mug1 T A 6: 121,861,533 (GRCm39) Y1332N probably damaging Het
Nalf2 GCCGCC GCCGCCACCGCC X: 98,864,971 (GRCm39) probably benign Het
Ndnf A G 6: 65,681,313 (GRCm39) T531A probably damaging Het
Ntsr2 T G 12: 16,709,766 (GRCm39) V349G probably damaging Het
Or2g25 A T 17: 37,970,672 (GRCm39) I184N probably damaging Het
P2ry14 A T 3: 59,022,467 (GRCm39) I331N probably benign Het
Pcdha11 T C 18: 37,138,577 (GRCm39) S69P possibly damaging Het
Ptp4a2 A G 4: 129,733,237 (GRCm39) probably benign Het
Ptpn13 A G 5: 103,741,446 (GRCm39) D2353G probably benign Het
Rasa2 GCC GCCCCC 9: 96,513,521 (GRCm39) probably benign Het
Raver2 A T 4: 100,960,195 (GRCm39) D225V probably damaging Het
Rph3a A T 5: 121,100,562 (GRCm39) probably null Het
Sin3a T A 9: 57,034,610 (GRCm39) V1261E possibly damaging Het
Slc12a9 T A 5: 137,323,812 (GRCm39) I368F probably damaging Het
Spaca1 CTCGC CTCGCTGTCGC 4: 34,049,853 (GRCm39) probably benign Het
Spata31h1 AA AACTGTCA 10: 82,126,826 (GRCm39) probably benign Het
Strn C CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTG 17: 78,984,717 (GRCm39) probably null Het
Ush2a A C 1: 187,995,666 (GRCm39) T146P probably damaging Het
Usp37 A G 1: 74,509,849 (GRCm39) L440P probably damaging Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 52,998,579 (GRCm39) missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52,985,463 (GRCm39) missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 52,988,824 (GRCm39) missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 52,990,896 (GRCm39) critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53,013,811 (GRCm39) missense probably benign
IGL03334:Xpnpep1 APN 19 52,998,577 (GRCm39) missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 52,998,583 (GRCm39) missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 52,994,784 (GRCm39) missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52,986,294 (GRCm39) splice site probably benign
R1543:Xpnpep1 UTSW 19 52,980,107 (GRCm39) missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 52,994,769 (GRCm39) missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 52,998,564 (GRCm39) missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 52,994,641 (GRCm39) missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 52,994,773 (GRCm39) missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3822:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3925:Xpnpep1 UTSW 19 52,980,128 (GRCm39) missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53,003,053 (GRCm39) missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 52,994,606 (GRCm39) missense probably benign
R5184:Xpnpep1 UTSW 19 53,001,845 (GRCm39) missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52,983,950 (GRCm39) missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 52,993,253 (GRCm39) missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52,985,439 (GRCm39) missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53,001,920 (GRCm39) missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52,986,310 (GRCm39) missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53,000,275 (GRCm39) missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53,000,196 (GRCm39) critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 52,998,538 (GRCm39) missense probably benign
R7412:Xpnpep1 UTSW 19 52,994,722 (GRCm39) missense probably benign
R8329:Xpnpep1 UTSW 19 52,990,903 (GRCm39) critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52,983,937 (GRCm39) missense probably benign 0.04
R9194:Xpnpep1 UTSW 19 53,000,289 (GRCm39) missense possibly damaging 0.68
R9342:Xpnpep1 UTSW 19 52,993,248 (GRCm39) missense probably benign 0.02
R9388:Xpnpep1 UTSW 19 52,993,233 (GRCm39) missense probably damaging 1.00
R9546:Xpnpep1 UTSW 19 52,990,959 (GRCm39) missense probably damaging 1.00
R9746:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGAGGATACCATGACTTTTC -3'
(R):5'- GGCTTATCTGAAACCTGGAGC -3'

Sequencing Primer
(F):5'- GGAGGATACCATGACTTTTCATTTCC -3'
(R):5'- TATCTGAAACCTGGAGCCATCCTG -3'
Posted On 2019-12-04