Incidental Mutation 'RF017:Xpnpep1'
ID603644
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene NameX-prolyl aminopeptidase (aminopeptidase P) 1, soluble
SynonymsD230045I08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF017 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location52943417-53040214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53032060 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 24 (I24L)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182097] [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
Predicted Effect probably benign
Transcript: ENSMUST00000182097
SMART Domains Protein: ENSMUSP00000138473
Gene: ENSMUSG00000025027

DomainStartEndE-ValueType
Pfam:Creatinase_N 9 119 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect probably benign
Transcript: ENSMUST00000183108
AA Change: I24L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: I24L

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183274
AA Change: I24L

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: I24L

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik AA AACTGTCA 10: 82,290,992 probably benign Het
Ahdc1 ACCACC ACCACCACC 4: 133,062,751 probably benign Het
Ankhd1 GGCGGC GGCGGCCGCGGC 18: 36,560,909 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
AY358078 T TAGGATAATGA 14: 51,805,593 probably null Het
Ccdc170 CCA CCAGCA 10: 4,561,024 probably benign Het
Cntrl C A 2: 35,175,189 D2168E probably damaging Het
Dab1 C A 4: 104,713,652 R195S probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGCGCACAGTTCCTACCTCGTT 9: 20,910,126 probably null Het
Elp6 A T 9: 110,319,709 H222L probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Fam71e1 GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGATCTGAGGGAGGA 7: 44,500,525 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgf22 A G 10: 79,756,846 H125R probably benign Het
Galnt18 G A 7: 111,599,014 R180C probably damaging Het
Gm4969 T C 7: 19,102,429 N291S unknown Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gpsm1 C A 2: 26,324,872 H288Q probably damaging Het
Ipo7 A G 7: 110,048,794 I628V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,138 probably benign Het
Krtap28-10 CCACCACAGCCACAG CCACCACAGCCACAGTCACCACAGCCACAG 1: 83,042,266 probably benign Het
Krtap4-2 CAGCAGGGGCGGCA C 11: 99,634,717 probably null Het
Krtap4-9 TGCTGTGTGTCCAGCTGCTGCAG TGCTGTGTGTCCAGCTGCTGCAGGCCCAGCGGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,399 probably benign Het
Larp4b G T 13: 9,123,910 G30V probably benign Het
Lrmp GCACATTG GCACATTGATCACATTG 6: 145,173,784 probably benign Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGGTCCAGCTCCA 2: 121,306,308 probably benign Het
Mccc2 A C 13: 100,000,288 V53G probably damaging Het
Mug1 T A 6: 121,884,574 Y1332N probably damaging Het
Ndnf A G 6: 65,704,329 T531A probably damaging Het
Ntsr2 T G 12: 16,659,765 V349G probably damaging Het
Olfr117 A T 17: 37,659,781 I184N probably damaging Het
P2ry14 A T 3: 59,115,046 I331N probably benign Het
Pcdha11 T C 18: 37,005,524 S69P possibly damaging Het
Ptp4a2 A G 4: 129,839,444 probably benign Het
Ptpn13 A G 5: 103,593,580 D2353G probably benign Het
Rasa2 GCC GCCCCC 9: 96,631,468 probably benign Het
Raver2 A T 4: 101,102,998 D225V probably damaging Het
Rph3a A T 5: 120,962,499 probably null Het
Sin3a T A 9: 57,127,326 V1261E possibly damaging Het
Slc12a9 T A 5: 137,325,550 I368F probably damaging Het
Spaca1 CTCGC CTCGCTGTCGC 4: 34,049,853 probably benign Het
Strn C CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTG 17: 78,677,288 probably null Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,365 probably benign Het
Ush2a A C 1: 188,263,469 T146P probably damaging Het
Usp37 A G 1: 74,470,690 L440P probably damaging Het
Wdr66 AAGAGGAGGAAGAGGAGGGGGAGAAGGAG AAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,890 probably benign Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 53010148 missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52997032 missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 53000393 missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 53002465 critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53025380 missense probably benign
IGL03334:Xpnpep1 APN 19 53010146 missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 53010152 missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 53006353 missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52997863 splice site probably benign
R1543:Xpnpep1 UTSW 19 52991676 missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 53006338 missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 53010133 missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 53006210 missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53013461 missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 53006342 missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3822:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3925:Xpnpep1 UTSW 19 52991697 missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53014622 missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 53006175 missense probably benign
R5184:Xpnpep1 UTSW 19 53013414 missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52995519 missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 53004822 missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52997008 missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53013489 missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52997879 missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53011844 missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53011765 critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 53010107 missense probably benign
R7412:Xpnpep1 UTSW 19 53006291 missense probably benign
R8329:Xpnpep1 UTSW 19 53002472 critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52995506 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTGGAGGATACCATGACTTTTC -3'
(R):5'- GGCTTATCTGAAACCTGGAGC -3'

Sequencing Primer
(F):5'- GGAGGATACCATGACTTTTCATTTCC -3'
(R):5'- TATCTGAAACCTGGAGCCATCCTG -3'
Posted On2019-12-04