Incidental Mutation 'RF018:Sirpa'
Institutional Source Beutler Lab
Gene Symbol Sirpa
Ensembl Gene ENSMUSG00000037902
Gene Namesignal-regulatory protein alpha
SynonymsSIRP, Ptpns1, CD172a, P84, SHPS-1, Bit
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF018 (G1)
Quality Score214.458
Status Not validated
Chromosomal Location129592835-129632228 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) TCATCAG to T at 129609203 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049262] [ENSMUST00000099113] [ENSMUST00000103202] [ENSMUST00000103203] [ENSMUST00000153491] [ENSMUST00000160276] [ENSMUST00000161620] [ENSMUST00000163034] [ENSMUST00000179001]
Predicted Effect probably null
Transcript: ENSMUST00000049262
SMART Domains Protein: ENSMUSP00000049022
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099113
SMART Domains Protein: ENSMUSP00000096713
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 228 240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103202
SMART Domains Protein: ENSMUSP00000099491
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103203
SMART Domains Protein: ENSMUSP00000099492
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153491
SMART Domains Protein: ENSMUSP00000120324
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160276
SMART Domains Protein: ENSMUSP00000125004
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161620
SMART Domains Protein: ENSMUSP00000124048
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163034
SMART Domains Protein: ENSMUSP00000124888
Gene: ENSMUSG00000037902

signal peptide 1 26 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179001
SMART Domains Protein: ENSMUSP00000137611
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the signal-regulatory-protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. This protein can be phosphorylated by tyrosine kinases. The phospho-tyrosine residues of this PTP have been shown to recruit SH2 domain containing tyrosine phosphatases (PTP), and serve as substrates of PTPs. This protein was found to participate in signal transduction mediated by various growth factor receptors. CD47 has been demonstrated to be a ligand for this receptor protein. This gene and its product share very high similarity with several other members of the SIRP family. These related genes are located in close proximity to each other on chromosome 20p13. Multiple alternatively spliced transcript variants have been determined for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display mild thrombocytopenia, fatty livers, decreased body weight, decreased proportion of single positive T cells, enhanced peritoneal macrophage phagocytosis and impaired Langerhans cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGCTGCT GTGGCTGCTTTGGCTGCT 1: 82,913,572 probably benign Het
Abca15 T A 7: 120,394,460 V1301E possibly damaging Het
Adcy10 T A 1: 165,552,109 V980E probably damaging Het
Aldh1a2 T C 9: 71,285,270 V469A probably damaging Het
Alk T A 17: 71,949,813 T684S probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,912 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
C130060K24Rik T A 6: 65,456,190 Y331* probably null Het
Ccdc81 C A 7: 89,866,698 probably null Het
Cd209g A G 8: 4,137,398 Y194C probably benign Het
Cenpc1 A T 5: 86,045,369 S220R possibly damaging Het
Ddx42 A T 11: 106,232,804 probably null Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
Eif5b A T 1: 38,021,592 probably null Het
Ell2 C A 13: 75,763,608 H338N probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Gnat2 T C 3: 108,096,329 S107P unknown Het
Guk1 T A 11: 59,186,408 D70V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Lamp3 A C 16: 19,701,250 I61R probably benign Het
Lrch1 GCTGGTGGTGT G 14: 74,947,555 probably null Het
Lrp1b C T 2: 41,110,907 E2216K Het
Lrrc27 A G 7: 139,226,100 D227G probably benign Het
Lrrk1 C T 7: 66,381,502 G16E possibly damaging Het
Lrrtm1 T A 6: 77,244,351 S264T possibly damaging Het
Mamld1 CAG CAGAAG X: 71,118,849 probably benign Het
Mpo G C 11: 87,797,639 A375P probably damaging Het
Myo9a A G 9: 59,869,586 H1089R probably benign Het
Ndufc2 T C 7: 97,407,021 *109Q probably null Het
Nudt16 A T 9: 105,131,699 Y28N probably damaging Het
Nudt4 A T 10: 95,549,813 probably null Het
Olfr697 T A 7: 106,741,485 I150F probably benign Het
P2ry12 T A 3: 59,217,412 T281S probably benign Het
P4ha2 TGTTGG T 11: 54,110,246 probably null Het
Pcnx2 A G 8: 125,877,519 V666A probably damaging Het
Pde6a T A 18: 61,231,403 I177N possibly damaging Het
Pgm2 A T 4: 99,962,303 probably null Het
Plce1 T A 19: 38,717,207 W1019R probably damaging Het
Plch1 C A 3: 63,721,215 K542N probably damaging Het
Plekhj1 T C 10: 80,796,637 Q113R not run Het
Postn A T 3: 54,384,492 I705F probably damaging Het
Ppp1r15b G T 1: 133,131,614 probably benign Het
Prkab1 T C 5: 116,021,630 E59G probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCTCACTC 12: 26,314,014 probably benign Het
Ros1 T A 10: 52,155,121 M484L probably benign Het
Rpa1 GCTGCTGCC GC 11: 75,318,517 probably null Het
Sectm1b A G 11: 121,054,930 V195A probably benign Het
Slc28a1 T A 7: 81,169,284 probably null Het
Sphk1 G C 11: 116,534,945 S42T possibly damaging Het
Spta1 T C 1: 174,209,319 L1132P probably damaging Het
Srrt A T 5: 137,300,000 N303K probably benign Het
Ssh2 A G 11: 77,454,054 E955G probably damaging Het
Tchhl1 T C 3: 93,470,384 F132L probably benign Het
Tex14 A G 11: 87,514,746 E828G probably benign Het
Tfeb CAG CAGGAG 17: 47,786,095 probably benign Het
Tmem28 CGCCGC CGCCGCTGCCGC X: 99,821,361 probably benign Het
Tmtc1 T C 6: 148,247,511 Y699C probably damaging Het
Ubn1 A G 16: 5,064,392 Y239C probably damaging Het
Vmn2r23 T G 6: 123,713,116 L317R probably benign Het
Vmn2r78 C T 7: 86,954,431 R606* probably null Het
Vps72 T G 3: 95,121,408 probably null Het
Zc3h11a A G 1: 133,627,115 S376P possibly damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGTCCCAGGC 6: 125,036,489 probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Zfp628 TACTCCTCCACCC T 7: 4,920,949 probably benign Het
Other mutations in Sirpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Sirpa APN 2 129609183 missense probably damaging 1.00
IGL01138:Sirpa APN 2 129630165 missense probably damaging 1.00
IGL01835:Sirpa APN 2 129615564 missense possibly damaging 0.76
IGL02558:Sirpa APN 2 129630069 missense probably damaging 1.00
IGL02825:Sirpa APN 2 129615452 missense probably damaging 0.99
IGL03083:Sirpa APN 2 129629928 missense probably damaging 1.00
R0234:Sirpa UTSW 2 129615468 missense probably damaging 0.99
R0234:Sirpa UTSW 2 129615468 missense probably damaging 0.99
R0831:Sirpa UTSW 2 129627936 splice site probably benign
R1550:Sirpa UTSW 2 129630041 missense probably damaging 1.00
R1772:Sirpa UTSW 2 129616456 missense probably damaging 0.99
R1806:Sirpa UTSW 2 129615512 missense probably damaging 1.00
R1927:Sirpa UTSW 2 129616376 missense possibly damaging 0.46
R2568:Sirpa UTSW 2 129615648 missense probably benign 0.02
R4849:Sirpa UTSW 2 129609243 missense probably damaging 1.00
R5182:Sirpa UTSW 2 129615732 missense possibly damaging 0.65
R5673:Sirpa UTSW 2 129630102 missense probably damaging 1.00
R5680:Sirpa UTSW 2 129616252 missense probably benign 0.02
R6521:Sirpa UTSW 2 129630155 missense probably damaging 1.00
R6821:Sirpa UTSW 2 129630097 missense probably damaging 1.00
R7602:Sirpa UTSW 2 129609152 missense probably damaging 1.00
R7637:Sirpa UTSW 2 129616445 missense probably benign 0.44
R8311:Sirpa UTSW 2 129616223 missense probably damaging 1.00
RF049:Sirpa UTSW 2 129609203 nonsense probably null
Z1088:Sirpa UTSW 2 129618535 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04