Incidental Mutation 'RF018:Tchhl1'
ID 603661
Institutional Source Beutler Lab
Gene Symbol Tchhl1
Ensembl Gene ENSMUSG00000027908
Gene Name trichohyalin-like 1
Synonyms S100a17, Thhl1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF018 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 93376061-93379287 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93377691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 132 (F132L)
Ref Sequence ENSEMBL: ENSMUSP00000029516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029516]
AlphaFold Q9D3P1
Predicted Effect probably benign
Transcript: ENSMUST00000029516
AA Change: F132L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029516
Gene: ENSMUSG00000027908
AA Change: F132L

DomainStartEndE-ValueType
Pfam:S_100 4 47 1.2e-15 PFAM
low complexity region 111 124 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the S100 fused-type protein (SFTP) gene family, and is located in a cluster of SFTP genes on chromosome 1q21. Several members of this family have been implicated in the development of complex skin disorders. This gene is evolutionarily conserved; its expression appears to be hair-specific and spatially restricted within the distal inner root sheath of the hair follicle. It thus may have an important role in hair morphogenesis. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGCTGCT GTGGCTGCTTTGGCTGCT 1: 82,891,293 (GRCm39) probably benign Het
Abca15 T A 7: 119,993,683 (GRCm39) V1301E possibly damaging Het
Adcy10 T A 1: 165,379,678 (GRCm39) V980E probably damaging Het
Aldh1a2 T C 9: 71,192,552 (GRCm39) V469A probably damaging Het
Alk T A 17: 72,256,808 (GRCm39) T684S probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,965 (GRCm39) probably benign Het
Anks1b G A 10: 89,869,087 (GRCm39) G49D probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,162,674 (GRCm39) probably null Het
Btnl10 CAAA CAAAAAA 11: 58,814,752 (GRCm39) probably benign Het
Ccdc81 C A 7: 89,515,906 (GRCm39) probably null Het
Cd209g A G 8: 4,187,398 (GRCm39) Y194C probably benign Het
Cenpc1 A T 5: 86,193,228 (GRCm39) S220R possibly damaging Het
Ddx42 A T 11: 106,123,630 (GRCm39) probably null Het
Dock4 GTGCCGGTGCCCGT G 12: 40,894,398 (GRCm39) probably null Het
Eif5b A T 1: 38,060,673 (GRCm39) probably null Het
Ell2 C A 13: 75,911,727 (GRCm39) H338N probably damaging Het
Entpd2 CTT CTTT 2: 25,290,907 (GRCm39) probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACGCACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,489,106 (GRCm39) probably null Het
Gnat2 T C 3: 108,003,645 (GRCm39) S107P unknown Het
Guk1 T A 11: 59,077,234 (GRCm39) D70V probably benign Het
Itpkb C T 1: 180,160,887 (GRCm39) R338W probably damaging Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCC ACCACAGCCACAGCCCCCACAGCCACAGCCACCACAGCCACAGCC 1: 83,019,974 (GRCm39) probably benign Het
Lamp3 A C 16: 19,520,000 (GRCm39) I61R probably benign Het
Lrch1 GCTGGTGGTGT G 14: 75,184,995 (GRCm39) probably null Het
Lrp1b C T 2: 41,000,919 (GRCm39) E2216K Het
Lrrc27 A G 7: 138,806,016 (GRCm39) D227G probably benign Het
Lrrk1 C T 7: 66,031,250 (GRCm39) G16E possibly damaging Het
Lrrtm1 T A 6: 77,221,334 (GRCm39) S264T possibly damaging Het
Lypd8 CCAATCACCAACA CCAATCACCAACAGTTTCCTCGCCTCTGTTACCCCACCAATCACCAACA 11: 58,281,058 (GRCm39) probably benign Het
Mamld1 CAG CAGAAG X: 70,162,455 (GRCm39) probably benign Het
Mpo G C 11: 87,688,465 (GRCm39) A375P probably damaging Het
Myo9a A G 9: 59,776,869 (GRCm39) H1089R probably benign Het
Nalf2 CGCCGC CGCCGCTGCCGC X: 98,864,967 (GRCm39) probably benign Het
Ndufc2 T C 7: 97,056,228 (GRCm39) *109Q probably null Het
Nudt16 A T 9: 105,008,898 (GRCm39) Y28N probably damaging Het
Nudt4 A T 10: 95,385,675 (GRCm39) probably null Het
Nusap1 AGATACACGTTAGCAGTGAGGAGCAAGCTG AGATACACGTTAGCAGTGAGGAGCAAGCTGCGATACACGTTAGCAGTGAGGAGCAAGCTG 2: 119,458,059 (GRCm39) probably benign Het
Or2ag15 T A 7: 106,340,692 (GRCm39) I150F probably benign Het
P2ry12 T A 3: 59,124,833 (GRCm39) T281S probably benign Het
P4ha2 TGTTGG T 11: 54,001,072 (GRCm39) probably null Het
Pcnx2 A G 8: 126,604,258 (GRCm39) V666A probably damaging Het
Pde6a T A 18: 61,364,475 (GRCm39) I177N possibly damaging Het
Pgm1 A T 4: 99,819,500 (GRCm39) probably null Het
Plce1 T A 19: 38,705,651 (GRCm39) W1019R probably damaging Het
Plch1 C A 3: 63,628,636 (GRCm39) K542N probably damaging Het
Plekhj1 T C 10: 80,632,471 (GRCm39) Q113R not run Het
Postn A T 3: 54,291,913 (GRCm39) I705F probably damaging Het
Ppp1r15b G T 1: 133,059,352 (GRCm39) probably benign Het
Prkab1 T C 5: 116,159,689 (GRCm39) E59G probably damaging Het
Qrfprl T A 6: 65,433,174 (GRCm39) Y331* probably null Het
Raph1 GG GGGGG 1: 60,528,426 (GRCm39) probably benign Het
Rassf6 AGCAATGGGGATTC AGCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGATTC 5: 90,756,788 (GRCm39) probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCTCACTC 12: 26,364,013 (GRCm39) probably benign Het
Ros1 T A 10: 52,031,217 (GRCm39) M484L probably benign Het
Rpa1 GCTGCTGCC GC 11: 75,209,343 (GRCm39) probably null Het
Sectm1b A G 11: 120,945,756 (GRCm39) V195A probably benign Het
Sirpa TCATCAG T 2: 129,451,123 (GRCm39) probably null Het
Slc28a1 T A 7: 80,819,032 (GRCm39) probably null Het
Sphk1 G C 11: 116,425,771 (GRCm39) S42T possibly damaging Het
Spta1 T C 1: 174,036,885 (GRCm39) L1132P probably damaging Het
Srrt A T 5: 137,298,262 (GRCm39) N303K probably benign Het
Ssh2 A G 11: 77,344,880 (GRCm39) E955G probably damaging Het
Strn CCAGTC CCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCACAGTC 17: 78,984,712 (GRCm39) probably null Het
Tex14 A G 11: 87,405,572 (GRCm39) E828G probably benign Het
Tfeb CAG CAGGAG 17: 48,097,020 (GRCm39) probably benign Het
Tmtc1 T C 6: 148,149,009 (GRCm39) Y699C probably damaging Het
Ubn1 A G 16: 4,882,256 (GRCm39) Y239C probably damaging Het
Vmn2r23 T G 6: 123,690,075 (GRCm39) L317R probably benign Het
Vmn2r78 C T 7: 86,603,639 (GRCm39) R606* probably null Het
Vps72 T G 3: 95,028,719 (GRCm39) probably null Het
Zc3h11a A G 1: 133,554,853 (GRCm39) S376P possibly damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGTCCCAGGC 6: 125,013,452 (GRCm39) probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,899,745 (GRCm39) probably benign Het
Zfp628 TACTCCTCCACCC T 7: 4,923,948 (GRCm39) probably benign Het
Other mutations in Tchhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Tchhl1 APN 3 93,378,230 (GRCm39) missense probably benign 0.00
IGL00803:Tchhl1 APN 3 93,378,207 (GRCm39) missense probably benign 0.00
IGL01075:Tchhl1 APN 3 93,377,623 (GRCm39) missense probably damaging 1.00
IGL01814:Tchhl1 APN 3 93,377,656 (GRCm39) missense possibly damaging 0.53
IGL02026:Tchhl1 APN 3 93,377,862 (GRCm39) missense probably damaging 0.99
IGL02407:Tchhl1 APN 3 93,378,634 (GRCm39) missense possibly damaging 0.95
IGL03286:Tchhl1 APN 3 93,378,430 (GRCm39) missense probably benign 0.00
IGL03293:Tchhl1 APN 3 93,377,582 (GRCm39) missense probably damaging 1.00
Reef UTSW 3 93,378,336 (GRCm39) nonsense probably null
R0371:Tchhl1 UTSW 3 93,376,884 (GRCm39) missense probably damaging 1.00
R0403:Tchhl1 UTSW 3 93,378,336 (GRCm39) nonsense probably null
R0763:Tchhl1 UTSW 3 93,378,878 (GRCm39) missense probably benign 0.05
R1052:Tchhl1 UTSW 3 93,377,520 (GRCm39) missense probably benign 0.32
R1848:Tchhl1 UTSW 3 93,378,408 (GRCm39) missense probably damaging 1.00
R4917:Tchhl1 UTSW 3 93,377,623 (GRCm39) missense possibly damaging 0.52
R4918:Tchhl1 UTSW 3 93,377,623 (GRCm39) missense possibly damaging 0.52
R4945:Tchhl1 UTSW 3 93,378,883 (GRCm39) missense probably benign 0.00
R5251:Tchhl1 UTSW 3 93,377,860 (GRCm39) missense possibly damaging 0.70
R5260:Tchhl1 UTSW 3 93,378,102 (GRCm39) missense probably damaging 1.00
R5398:Tchhl1 UTSW 3 93,378,910 (GRCm39) missense probably benign 0.01
R5759:Tchhl1 UTSW 3 93,378,863 (GRCm39) missense probably damaging 1.00
R5760:Tchhl1 UTSW 3 93,378,863 (GRCm39) missense probably damaging 1.00
R5872:Tchhl1 UTSW 3 93,377,836 (GRCm39) missense probably benign 0.31
R6592:Tchhl1 UTSW 3 93,378,116 (GRCm39) missense probably damaging 0.99
R7464:Tchhl1 UTSW 3 93,377,971 (GRCm39) missense probably benign 0.01
R7653:Tchhl1 UTSW 3 93,378,451 (GRCm39) missense probably benign 0.01
R7726:Tchhl1 UTSW 3 93,379,065 (GRCm39) missense probably benign 0.07
R8487:Tchhl1 UTSW 3 93,376,869 (GRCm39) missense probably damaging 1.00
R9207:Tchhl1 UTSW 3 93,377,819 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTTCTGAATTTTGACAGAGATGG -3'
(R):5'- GCTGGTACATTTTGTGCGAC -3'

Sequencing Primer
(F):5'- GGTACCATCAGTTTTGAGGAATTTG -3'
(R):5'- GTGCGACTTCCTGAGCATC -3'
Posted On 2019-12-04