Incidental Mutation 'RF018:Rassf6'
ID 603665
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # RF018 (G1)
Quality Score 215.468
Status Not validated
Chromosome 5
Chromosomal Location 90750935-90788516 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) AGCAATGGGGATTC to AGCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGATTC at 90756788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGCTGCT GTGGCTGCTTTGGCTGCT 1: 82,891,293 (GRCm39) probably benign Het
Abca15 T A 7: 119,993,683 (GRCm39) V1301E possibly damaging Het
Adcy10 T A 1: 165,379,678 (GRCm39) V980E probably damaging Het
Aldh1a2 T C 9: 71,192,552 (GRCm39) V469A probably damaging Het
Alk T A 17: 72,256,808 (GRCm39) T684S probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,965 (GRCm39) probably benign Het
Anks1b G A 10: 89,869,087 (GRCm39) G49D probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,162,674 (GRCm39) probably null Het
Btnl10 CAAA CAAAAAA 11: 58,814,752 (GRCm39) probably benign Het
Ccdc81 C A 7: 89,515,906 (GRCm39) probably null Het
Cd209g A G 8: 4,187,398 (GRCm39) Y194C probably benign Het
Cenpc1 A T 5: 86,193,228 (GRCm39) S220R possibly damaging Het
Ddx42 A T 11: 106,123,630 (GRCm39) probably null Het
Dock4 GTGCCGGTGCCCGT G 12: 40,894,398 (GRCm39) probably null Het
Eif5b A T 1: 38,060,673 (GRCm39) probably null Het
Ell2 C A 13: 75,911,727 (GRCm39) H338N probably damaging Het
Entpd2 CTT CTTT 2: 25,290,907 (GRCm39) probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACGCACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,489,106 (GRCm39) probably null Het
Gnat2 T C 3: 108,003,645 (GRCm39) S107P unknown Het
Guk1 T A 11: 59,077,234 (GRCm39) D70V probably benign Het
Itpkb C T 1: 180,160,887 (GRCm39) R338W probably damaging Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCC ACCACAGCCACAGCCCCCACAGCCACAGCCACCACAGCCACAGCC 1: 83,019,974 (GRCm39) probably benign Het
Lamp3 A C 16: 19,520,000 (GRCm39) I61R probably benign Het
Lrch1 GCTGGTGGTGT G 14: 75,184,995 (GRCm39) probably null Het
Lrp1b C T 2: 41,000,919 (GRCm39) E2216K Het
Lrrc27 A G 7: 138,806,016 (GRCm39) D227G probably benign Het
Lrrk1 C T 7: 66,031,250 (GRCm39) G16E possibly damaging Het
Lrrtm1 T A 6: 77,221,334 (GRCm39) S264T possibly damaging Het
Lypd8 CCAATCACCAACA CCAATCACCAACAGTTTCCTCGCCTCTGTTACCCCACCAATCACCAACA 11: 58,281,058 (GRCm39) probably benign Het
Mamld1 CAG CAGAAG X: 70,162,455 (GRCm39) probably benign Het
Mpo G C 11: 87,688,465 (GRCm39) A375P probably damaging Het
Myo9a A G 9: 59,776,869 (GRCm39) H1089R probably benign Het
Nalf2 CGCCGC CGCCGCTGCCGC X: 98,864,967 (GRCm39) probably benign Het
Ndufc2 T C 7: 97,056,228 (GRCm39) *109Q probably null Het
Nudt16 A T 9: 105,008,898 (GRCm39) Y28N probably damaging Het
Nudt4 A T 10: 95,385,675 (GRCm39) probably null Het
Nusap1 AGATACACGTTAGCAGTGAGGAGCAAGCTG AGATACACGTTAGCAGTGAGGAGCAAGCTGCGATACACGTTAGCAGTGAGGAGCAAGCTG 2: 119,458,059 (GRCm39) probably benign Het
Or2ag15 T A 7: 106,340,692 (GRCm39) I150F probably benign Het
P2ry12 T A 3: 59,124,833 (GRCm39) T281S probably benign Het
P4ha2 TGTTGG T 11: 54,001,072 (GRCm39) probably null Het
Pcnx2 A G 8: 126,604,258 (GRCm39) V666A probably damaging Het
Pde6a T A 18: 61,364,475 (GRCm39) I177N possibly damaging Het
Pgm1 A T 4: 99,819,500 (GRCm39) probably null Het
Plce1 T A 19: 38,705,651 (GRCm39) W1019R probably damaging Het
Plch1 C A 3: 63,628,636 (GRCm39) K542N probably damaging Het
Plekhj1 T C 10: 80,632,471 (GRCm39) Q113R not run Het
Postn A T 3: 54,291,913 (GRCm39) I705F probably damaging Het
Ppp1r15b G T 1: 133,059,352 (GRCm39) probably benign Het
Prkab1 T C 5: 116,159,689 (GRCm39) E59G probably damaging Het
Qrfprl T A 6: 65,433,174 (GRCm39) Y331* probably null Het
Raph1 GG GGGGG 1: 60,528,426 (GRCm39) probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCTCACTC 12: 26,364,013 (GRCm39) probably benign Het
Ros1 T A 10: 52,031,217 (GRCm39) M484L probably benign Het
Rpa1 GCTGCTGCC GC 11: 75,209,343 (GRCm39) probably null Het
Sectm1b A G 11: 120,945,756 (GRCm39) V195A probably benign Het
Sirpa TCATCAG T 2: 129,451,123 (GRCm39) probably null Het
Slc28a1 T A 7: 80,819,032 (GRCm39) probably null Het
Sphk1 G C 11: 116,425,771 (GRCm39) S42T possibly damaging Het
Spta1 T C 1: 174,036,885 (GRCm39) L1132P probably damaging Het
Srrt A T 5: 137,298,262 (GRCm39) N303K probably benign Het
Ssh2 A G 11: 77,344,880 (GRCm39) E955G probably damaging Het
Strn CCAGTC CCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCACAGTC 17: 78,984,712 (GRCm39) probably null Het
Tchhl1 T C 3: 93,377,691 (GRCm39) F132L probably benign Het
Tex14 A G 11: 87,405,572 (GRCm39) E828G probably benign Het
Tfeb CAG CAGGAG 17: 48,097,020 (GRCm39) probably benign Het
Tmtc1 T C 6: 148,149,009 (GRCm39) Y699C probably damaging Het
Ubn1 A G 16: 4,882,256 (GRCm39) Y239C probably damaging Het
Vmn2r23 T G 6: 123,690,075 (GRCm39) L317R probably benign Het
Vmn2r78 C T 7: 86,603,639 (GRCm39) R606* probably null Het
Vps72 T G 3: 95,028,719 (GRCm39) probably null Het
Zc3h11a A G 1: 133,554,853 (GRCm39) S376P possibly damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGTCCCAGGC 6: 125,013,452 (GRCm39) probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,899,745 (GRCm39) probably benign Het
Zfp628 TACTCCTCCACCC T 7: 4,923,948 (GRCm39) probably benign Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90,751,999 (GRCm39) missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90,751,930 (GRCm39) missense probably benign 0.03
IGL01139:Rassf6 APN 5 90,756,825 (GRCm39) makesense probably null
IGL03114:Rassf6 APN 5 90,756,649 (GRCm39) splice site probably benign
R1956:Rassf6 UTSW 5 90,763,730 (GRCm39) nonsense probably null
R2167:Rassf6 UTSW 5 90,751,797 (GRCm39) missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90,779,418 (GRCm39) missense probably benign 0.05
R2877:Rassf6 UTSW 5 90,754,664 (GRCm39) missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90,757,646 (GRCm39) missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90,752,225 (GRCm39) critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90,754,699 (GRCm39) missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90,751,977 (GRCm39) missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90,765,627 (GRCm39) missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90,751,736 (GRCm39) missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90,757,633 (GRCm39) missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90,757,584 (GRCm39) missense probably benign 0.13
R7190:Rassf6 UTSW 5 90,754,666 (GRCm39) missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90,754,661 (GRCm39) missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90,779,391 (GRCm39) missense possibly damaging 0.83
R9472:Rassf6 UTSW 5 90,765,572 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,784 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF004:Rassf6 UTSW 5 90,756,778 (GRCm39) utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90,756,800 (GRCm39) utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,776 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,771 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90,756,767 (GRCm39) utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,789 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,791 (GRCm39) utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90,756,772 (GRCm39) utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,775 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,790 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,770 (GRCm39) utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90,756,801 (GRCm39) nonsense probably null
X0017:Rassf6 UTSW 5 90,754,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGCATCTGCTACCGCTG -3'
(R):5'- GCCAGGAAATAGCAGTCATTCTTG -3'

Sequencing Primer
(F):5'- CCGCTGTTATTACTAACTTGAATGC -3'
(R):5'- TCTTGTTAATAAAAGCACGCCAGCG -3'
Posted On 2019-12-04