Incidental Mutation 'RF018:Srrt'
Institutional Source Beutler Lab
Gene Symbol Srrt
Ensembl Gene ENSMUSG00000037364
Gene Nameserrate RNA effector molecule homolog (Arabidopsis)
Synonyms2810019G02Rik, Asr2, Ars2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF018 (G1)
Quality Score225.009
Status Validated
Chromosomal Location137295704-137307674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137300000 bp
Amino Acid Change Asparagine to Lysine at position 303 (N303K)
Ref Sequence ENSEMBL: ENSMUSP00000143232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040873] [ENSMUST00000052825] [ENSMUST00000196109] [ENSMUST00000197466] [ENSMUST00000197484] [ENSMUST00000198526] [ENSMUST00000199243]
Predicted Effect probably benign
Transcript: ENSMUST00000040873
AA Change: N303K

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364
AA Change: N303K

low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052825
SMART Domains Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

Pfam:Peptidase_C78 27 212 5.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196109
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364

coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197466
AA Change: N303K

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364
AA Change: N303K

low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197484
SMART Domains Protein: ENSMUSP00000142660
Gene: ENSMUSG00000037364

low complexity region 3 41 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198526
AA Change: N303K

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364
AA Change: N303K

low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199243
AA Change: N303K

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364
AA Change: N303K

low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000199756
Predicted Effect probably benign
Transcript: ENSMUST00000223263
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation, increased apoptosis, and when cultured most fail to hatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGCTGCT GTGGCTGCTTTGGCTGCT 1: 82,913,572 probably benign Het
Abca15 T A 7: 120,394,460 V1301E possibly damaging Het
Adcy10 T A 1: 165,552,109 V980E probably damaging Het
Aldh1a2 T C 9: 71,285,270 V469A probably damaging Het
Alk T A 17: 71,949,813 T684S probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,912 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
C130060K24Rik T A 6: 65,456,190 Y331* probably null Het
Ccdc81 C A 7: 89,866,698 probably null Het
Cd209g A G 8: 4,137,398 Y194C probably benign Het
Cenpc1 A T 5: 86,045,369 S220R possibly damaging Het
Ddx42 A T 11: 106,232,804 probably null Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
Eif5b A T 1: 38,021,592 probably null Het
Ell2 C A 13: 75,763,608 H338N probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Gnat2 T C 3: 108,096,329 S107P unknown Het
Guk1 T A 11: 59,186,408 D70V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Lamp3 A C 16: 19,701,250 I61R probably benign Het
Lrch1 GCTGGTGGTGT G 14: 74,947,555 probably null Het
Lrp1b C T 2: 41,110,907 E2216K Het
Lrrc27 A G 7: 139,226,100 D227G probably benign Het
Lrrk1 C T 7: 66,381,502 G16E possibly damaging Het
Lrrtm1 T A 6: 77,244,351 S264T possibly damaging Het
Mamld1 CAG CAGAAG X: 71,118,849 probably benign Het
Mpo G C 11: 87,797,639 A375P probably damaging Het
Myo9a A G 9: 59,869,586 H1089R probably benign Het
Ndufc2 T C 7: 97,407,021 *109Q probably null Het
Nudt16 A T 9: 105,131,699 Y28N probably damaging Het
Nudt4 A T 10: 95,549,813 probably null Het
Olfr697 T A 7: 106,741,485 I150F probably benign Het
P2ry12 T A 3: 59,217,412 T281S probably benign Het
P4ha2 TGTTGG T 11: 54,110,246 probably null Het
Pcnx2 A G 8: 125,877,519 V666A probably damaging Het
Pde6a T A 18: 61,231,403 I177N possibly damaging Het
Pgm2 A T 4: 99,962,303 probably null Het
Plce1 T A 19: 38,717,207 W1019R probably damaging Het
Plch1 C A 3: 63,721,215 K542N probably damaging Het
Plekhj1 T C 10: 80,796,637 Q113R not run Het
Postn A T 3: 54,384,492 I705F probably damaging Het
Ppp1r15b G T 1: 133,131,614 probably benign Het
Prkab1 T C 5: 116,021,630 E59G probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCTCACTC 12: 26,314,014 probably benign Het
Ros1 T A 10: 52,155,121 M484L probably benign Het
Rpa1 GCTGCTGCC GC 11: 75,318,517 probably null Het
Sectm1b A G 11: 121,054,930 V195A probably benign Het
Sirpa TCATCAG T 2: 129,609,203 probably null Het
Slc28a1 T A 7: 81,169,284 probably null Het
Sphk1 G C 11: 116,534,945 S42T possibly damaging Het
Spta1 T C 1: 174,209,319 L1132P probably damaging Het
Ssh2 A G 11: 77,454,054 E955G probably damaging Het
Tchhl1 T C 3: 93,470,384 F132L probably benign Het
Tex14 A G 11: 87,514,746 E828G probably benign Het
Tfeb CAG CAGGAG 17: 47,786,095 probably benign Het
Tmem28 CGCCGC CGCCGCTGCCGC X: 99,821,361 probably benign Het
Tmtc1 T C 6: 148,247,511 Y699C probably damaging Het
Ubn1 A G 16: 5,064,392 Y239C probably damaging Het
Vmn2r23 T G 6: 123,713,116 L317R probably benign Het
Vmn2r78 C T 7: 86,954,431 R606* probably null Het
Vps72 T G 3: 95,121,408 probably null Het
Zc3h11a A G 1: 133,627,115 S376P possibly damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGTCCCAGGC 6: 125,036,489 probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Zfp628 TACTCCTCCACCC T 7: 4,920,949 probably benign Het
Other mutations in Srrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Srrt APN 5 137295978 unclassified probably benign
IGL01062:Srrt APN 5 137296307 missense probably damaging 1.00
IGL02227:Srrt APN 5 137296274 missense probably damaging 1.00
IGL02656:Srrt APN 5 137299676 unclassified probably benign
IGL03105:Srrt APN 5 137299844 missense possibly damaging 0.72
IGL03137:Srrt APN 5 137296117 unclassified probably benign
R0281:Srrt UTSW 5 137296127 unclassified probably benign
R0322:Srrt UTSW 5 137296608 missense probably damaging 1.00
R0347:Srrt UTSW 5 137299676 unclassified probably benign
R1253:Srrt UTSW 5 137300336 missense probably benign 0.01
R1397:Srrt UTSW 5 137300261 missense possibly damaging 0.89
R1520:Srrt UTSW 5 137298766 missense probably damaging 0.99
R1561:Srrt UTSW 5 137300019 missense probably benign 0.24
R1645:Srrt UTSW 5 137302139 nonsense probably null
R1759:Srrt UTSW 5 137302950 missense probably damaging 1.00
R1770:Srrt UTSW 5 137299860 unclassified probably benign
R1795:Srrt UTSW 5 137303012 unclassified probably benign
R1848:Srrt UTSW 5 137296945 missense probably damaging 1.00
R3838:Srrt UTSW 5 137302125 critical splice donor site probably null
R5015:Srrt UTSW 5 137296009 missense probably damaging 1.00
R5068:Srrt UTSW 5 137296541 missense possibly damaging 0.93
R5163:Srrt UTSW 5 137296773 critical splice donor site probably null
R5316:Srrt UTSW 5 137296551 missense probably benign 0.16
R5343:Srrt UTSW 5 137297165 missense probably damaging 1.00
R5351:Srrt UTSW 5 137298284 makesense probably null
R5412:Srrt UTSW 5 137296287 missense probably damaging 1.00
R5806:Srrt UTSW 5 137297917 missense probably damaging 0.98
R6470:Srrt UTSW 5 137302656 missense probably damaging 1.00
R6497:Srrt UTSW 5 137297506 missense probably damaging 1.00
R6755:Srrt UTSW 5 137302930 missense probably damaging 1.00
R6828:Srrt UTSW 5 137296968 missense probably damaging 1.00
R6875:Srrt UTSW 5 137298673 missense probably benign 0.00
R7586:Srrt UTSW 5 137302195 missense probably damaging 0.98
R7677:Srrt UTSW 5 137300148 missense probably damaging 0.99
R8028:Srrt UTSW 5 137302498 critical splice donor site probably benign
R8413:Srrt UTSW 5 137300327 missense possibly damaging 0.84
R8438:Srrt UTSW 5 137303000 missense unknown
R8795:Srrt UTSW 5 137299976 missense probably benign 0.17
R8925:Srrt UTSW 5 137298808 missense probably benign 0.26
R8927:Srrt UTSW 5 137298808 missense probably benign 0.26
Z1176:Srrt UTSW 5 137298227 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04